ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl18a01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC026179.5|AC026179 Homo sapiens chromosome 3 clone RP11-264H... 42 0.32
2gb|AC066584.6|AC066584 Homo sapiens chromosome 3 clone RP11-244G... 42 0.32
3gb|AC018493.6|AC018493 Homo sapiens chromosome 3 clone RP11-163M... 42 0.32
4gb|AC011327.17|AC011327 Homo sapiens 3 BAC RP11-77I5 (Roswell Pa... 42 0.32
5emb|AL935264.12| Mouse DNA sequence from clone RP23-118A9 on chr... 42 0.32
6gb|AC023485.6| Homo sapiens chromosome 3 clone RP11-489D19 map 3... 42 0.32
7gb|AY633104.1| Cicurina pallida haplotype TX365 cytochrome oxida... 40 1.3
8gb|AY633103.1| Cicurina pallida haplotype TX363 cytochrome oxida... 40 1.3
9gb|AC135239.3| Mus musculus BAC clone RP23-324D2 from chromosome... 40 1.3
10gb|AC163212.3| Mus musculus chromosome 3, clone RP24-102O2, comp... 40 1.3
11gb|DQ174430.1| Diaea sp. JEG-696 cytochrome oxidase subunit I (C... 40 1.3
12gb|DQ174429.1| Diaea sp. JEG-697 cytochrome oxidase subunit I (C... 40 1.3
13gb|DQ174399.1| Diaea sp. JEG-692 cytochrome oxidase subunit I (C... 40 1.3
14gb|DQ174374.1| Misumenops melloleitaio isolate 368 cytochrome ox... 40 1.3
15gb|DQ174373.1| Misumenops melloleitaio isolate 484 cytochrome ox... 40 1.3
16gb|AC166105.4| Mus musculus BAC clone RP23-251L22 from chromosom... 38 5.0
17gb|AC134842.3| Mus musculus BAC clone RP24-375P18 from chromosom... 38 5.0
18emb|CR450741.5| Zebrafish DNA sequence from clone CH211-269F16 i... 38 5.0
19gb|AC114543.10| Mus musculus, clone RP24-107C11, complete sequence 38 5.0
20gb|DQ174370.1| Misumenops dalmasi isolate 657 cytochrome oxidase... 38 5.0
21gb|DQ174367.1| Misumenops dalmasi isolate 479 cytochrome oxidase... 38 5.0
22gb|AC147892.2| Xenopus tropicalis clone CH216-35D21, complete se... 38 5.0
23gb|AC092601.3| Homo sapiens BAC clone RP11-125M15 from 2, comple... 38 5.0
24emb|BX537129.6| Zebrafish DNA sequence from clone CH211-236I20 i... 38 5.0
25gb|AC142266.3| Mus musculus BAC clone RP24-380K14 from 14, compl... 38 5.0

>gb|AC026179.5|AC026179 Homo sapiens chromosome 3 clone RP11-264H3 map 3p, complete sequence
          Length = 166488

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 36     atgtacttactttacatggat 56
              |||||||||||||||||||||
Sbjct: 152625 atgtacttactttacatggat 152605



to top

>gb|AC066584.6|AC066584 Homo sapiens chromosome 3 clone RP11-244G3 map 3p, complete sequence
          Length = 155825

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 36    atgtacttactttacatggat 56
             |||||||||||||||||||||
Sbjct: 76775 atgtacttactttacatggat 76755



to top

>gb|AC018493.6|AC018493 Homo sapiens chromosome 3 clone RP11-163M22 map 3p, complete sequence
          Length = 180299

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 36     atgtacttactttacatggat 56
              |||||||||||||||||||||
Sbjct: 171146 atgtacttactttacatggat 171166



to top

>gb|AC011327.17|AC011327 Homo sapiens 3 BAC RP11-77I5 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 168812

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 36     atgtacttactttacatggat 56
              |||||||||||||||||||||
Sbjct: 159653 atgtacttactttacatggat 159673



to top

>emb|AL935264.12| Mouse DNA sequence from clone RP23-118A9 on chromosome 4, complete
             sequence
          Length = 230886

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 20    ctgcactttattggggatgta 40
             |||||||||||||||||||||
Sbjct: 26959 ctgcactttattggggatgta 26939



to top

>gb|AC023485.6| Homo sapiens chromosome 3 clone RP11-489D19 map 3p, complete sequence
          Length = 179304

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 36     atgtacttactttacatggat 56
              |||||||||||||||||||||
Sbjct: 100248 atgtacttactttacatggat 100228



to top

>gb|AY633104.1| Cicurina pallida haplotype TX365 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 984

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 43  tactttacatggatcttatt 62
           ||||||||||||||||||||
Sbjct: 678 tactttacatggatcttatt 697



to top

>gb|AY633103.1| Cicurina pallida haplotype TX363 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 966

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 43  tactttacatggatcttatt 62
           ||||||||||||||||||||
Sbjct: 660 tactttacatggatcttatt 679



to top

>gb|AC135239.3| Mus musculus BAC clone RP23-324D2 from chromosome 3, complete sequence
          Length = 190178

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 22    gcactttattggggatgtacttac 45
             |||||| |||||||||||||||||
Sbjct: 91501 gcacttaattggggatgtacttac 91524



to top

>gb|AC163212.3| Mus musculus chromosome 3, clone RP24-102O2, complete sequence
          Length = 199319

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 22    gcactttattggggatgtacttac 45
             |||||| |||||||||||||||||
Sbjct: 61943 gcacttaattggggatgtacttac 61966



to top

>gb|DQ174430.1| Diaea sp. JEG-696 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 43  tactttacatggatcttatt 62
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793



to top

>gb|DQ174429.1| Diaea sp. JEG-697 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 43  tactttacatggatcttatt 62
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793



to top

>gb|DQ174399.1| Diaea sp. JEG-692 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 43  tactttacatggatcttatt 62
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793



to top

>gb|DQ174374.1| Misumenops melloleitaio isolate 368 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 43  tactttacatggatcttatt 62
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793



to top

>gb|DQ174373.1| Misumenops melloleitaio isolate 484 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 819

 Score = 40.1 bits (20), Expect = 1.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 43  tactttacatggatcttatt 62
           ||||||||||||||||||||
Sbjct: 773 tactttacatggatcttatt 792



to top

>gb|AC166105.4| Mus musculus BAC clone RP23-251L22 from chromosome 14, complete sequence
          Length = 231837

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 61     ttccagtactcagctcaat 79
              |||||||||||||||||||
Sbjct: 104553 ttccagtactcagctcaat 104535



to top

>gb|AC134842.3| Mus musculus BAC clone RP24-375P18 from chromosome 14, complete
             sequence
          Length = 154676

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    atcttattccagtactcag 73
             |||||||||||||||||||
Sbjct: 60974 atcttattccagtactcag 60992



to top

>emb|CR450741.5| Zebrafish DNA sequence from clone CH211-269F16 in linkage group 24,
             complete sequence
          Length = 157603

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 26    tttattggggatgtacttacttt 48
             ||||||||||||||| |||||||
Sbjct: 32049 tttattggggatgtaattacttt 32071



to top

>gb|AC114543.10| Mus musculus, clone RP24-107C11, complete sequence
          Length = 191639

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 61    ttccagtactcagctcaat 79
             |||||||||||||||||||
Sbjct: 14790 ttccagtactcagctcaat 14808



to top

>gb|DQ174370.1| Misumenops dalmasi isolate 657 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 820

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 44  actttacatggatcttatt 62
           |||||||||||||||||||
Sbjct: 775 actttacatggatcttatt 793



to top

>gb|DQ174367.1| Misumenops dalmasi isolate 479 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 820

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 44  actttacatggatcttatt 62
           |||||||||||||||||||
Sbjct: 775 actttacatggatcttatt 793



to top

>gb|AC147892.2| Xenopus tropicalis clone CH216-35D21, complete sequence
          Length = 178580

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    ctttacatggatcttattc 63
             |||||||||||||||||||
Sbjct: 66042 ctttacatggatcttattc 66024



to top

>gb|AC092601.3| Homo sapiens BAC clone RP11-125M15 from 2, complete sequence
          Length = 198364

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 43    tactttacatggatcttat 61
             |||||||||||||||||||
Sbjct: 23318 tactttacatggatcttat 23336



to top

>emb|BX537129.6| Zebrafish DNA sequence from clone CH211-236I20 in linkage group 18,
              complete sequence
          Length = 166655

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 26     tttattggggatgtacttacttt 48
              ||||||||||||||| |||||||
Sbjct: 113751 tttattggggatgtaattacttt 113729



to top

>gb|AC142266.3| Mus musculus BAC clone RP24-380K14 from 14, complete sequence
          Length = 185704

 Score = 38.2 bits (19), Expect = 5.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 55     atcttattccagtactcag 73
              |||||||||||||||||||
Sbjct: 179066 atcttattccagtactcag 179084


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 796,258
Number of Sequences: 3902068
Number of extensions: 796258
Number of successful extensions: 47105
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47071
Number of HSP's gapped (non-prelim): 34
length of query: 110
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 89
effective length of database: 17,151,101,840
effective search space: 1526448063760
effective search space used: 1526448063760
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top