ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl17h10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC129324.4| Mus musculus BAC clone RP23-253G24 from chromosom... 48 0.017
2gb|U66061.1| Human germline T-cell receptor beta chain TCRBV17S1... 42 1.0
3ref|NG_001333.1| Homo sapiens T cell receptor beta locus (TRB@) ... 42 1.0
4gb|AC146433.3| Pan troglodytes BAC clone RP43-19C19 from 7, comp... 42 1.0
5gb|AC124405.4| Mus musculus BAC clone RP24-372I6 from chromosome... 42 1.0
6gb|AF029308.1|HTCRBCHR9 Homo sapiens chromosome 9 duplication of... 42 1.0
7emb|AL356489.14| Human DNA sequence from clone RP11-384P7 on chr... 42 1.0
8gb|AC091770.5| Homo sapiens BAC clone RP11-655M5 from 7, complet... 42 1.0
9gb|AC148347.13| Medicago truncatula clone mth2-26g24, complete s... 42 1.0
10gb|AF491780.1| Homo sapiens neuregulin 1 (NRG1) gene, partial cd... 42 1.0
11emb|AL139008.10| Human DNA sequence from clone RP11-255A11 on ch... 42 1.0
12emb|AL023913.6|HS1068F16 Human DNA sequence from clone RP5-1068F... 42 1.0
13emb|AJ493124.1|VDE493124 Varroa destructor complete mitochondria... 42 1.0
14ref|NG_001337.1| Homo sapiens T cell receptor beta variable orph... 42 1.0
15gb|AC148525.14| Medicago truncatula clone mth2-24i13, complete s... 42 1.0
16gb|AC022833.5| Homo sapiens chromosome , clone RP11-147C21, comp... 42 1.0
17gb|AC016583.8| Homo sapiens chromosome 5 clone CTD-2591A1, compl... 42 1.0
18tpg|BK000383.1| TPA: TPA_exp: Homo sapiens neuregulin 1 isoform ... 42 1.0
19gb|AY163547.1| Varroa destructor mitochondrion, complete genome 42 1.0
20gb|DP000017.1| Sus scrofa target 1 genomic scaffold 40 4.1
21gb|AC091263.15| Mus musculus chromosome 9, clone RP23-134F1, com... 40 4.1
22gb|AC150687.3| Bos taurus BAC CH240-243M2 (Children's Hospital ... 40 4.1
23gb|AC149774.2| Bos taurus BAC CH240-10G15 (Children's Hospital ... 40 4.1
24gb|AC158704.3| Microcebus murinus clone CH257-434D18, complete s... 40 4.1
25gb|AC087423.2| Sus scrofa clone RP44-55G2, complete sequence 40 4.1
26gb|AC146263.2| Pan troglodytes BAC clone RP43-28O1 from 7, compl... 40 4.1
27gb|AC147343.2| Pan troglodytes BAC clone CH251-14P15 from Y, com... 40 4.1
28gb|AC147117.2| Pan troglodytes BAC clone CH251-532B3 from Y, com... 40 4.1
29ref|XM_719404.1| Plasmodium yoelii yoelii str. 17XNL insulinase ... 40 4.1
30gb|AE004392.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 40 4.1
31ref|XM_739172.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 4.1
32gb|AC098592.5| Homo sapiens BAC clone RP11-403N12 from 7, comple... 40 4.1
33gb|AC006148.3| Homo sapiens PAC clone RP5-902E20 from 7, complet... 40 4.1
34gb|AC146057.2| Pan troglodytes BAC clone RP43-90E18 from 7, comp... 40 4.1
35emb|Z99129.1|HS425C14 Human DNA sequence from clone RP3-425C14 o... 40 4.1
36emb|AL646087.8| Human DNA sequence from clone RP11-412K4 on chro... 40 4.1
37emb|AL592466.9| Human DNA sequence from clone RP11-428G2 on chro... 40 4.1
38emb|AL592227.4| Human DNA sequence from clone RP11-32D4 on chrom... 40 4.1
39emb|AL450472.14| Human DNA sequence from clone RP11-265D19 on ch... 40 4.1
40emb|AL359979.10| Human DNA sequence from clone RP11-239E10 on ch... 40 4.1
41emb|AL359771.27| Human DNA sequence from clone CTA-520D8 on chro... 40 4.1
42emb|AL355586.27| Human DNA sequence from clone RP11-59I9 on chro... 40 4.1
43emb|AL355303.16| Human DNA sequence from clone RP11-445P17 on ch... 40 4.1
44emb|AL356534.12| Human DNA sequence from clone RP11-629P13 on ch... 40 4.1
45emb|AL355516.12| Human DNA sequence from clone RP11-442J17 on ch... 40 4.1
46emb|AL355607.10| Human DNA sequence from clone RP11-367F23 on ch... 40 4.1
47emb|AL162596.30| Human DNA sequence from clone RP1-13P20 on chro... 40 4.1
48gb|AC105275.3| Homo sapiens chromosome 1 clone RP11-359E8, compl... 40 4.1
49emb|AL158218.11| Human DNA sequence from clone RP5-831K15 on chr... 40 4.1
50emb|AL157828.14| Human DNA sequence from clone RP11-214I20 on ch... 40 4.1
51gb|AC090571.5| Homo sapiens chromosome 8, clone RP11-313J18, com... 40 4.1
52gb|AC105180.8| Homo sapiens chromosome 8, clone RP11-345J1, comp... 40 4.1
53gb|AC068446.22| Homo sapiens chromosome 15, clone RP11-32B5, com... 40 4.1
54emb|AL033530.1|HS629A15 Human DNA sequence from clone RP4-629A15... 40 4.1
55gb|AC021580.9| Homo sapiens chromosome 9, clone RP11-1091N2, com... 40 4.1
56gb|AC015528.14| Homo sapiens chromosome 8, clone RP11-179A23, co... 40 4.1
57dbj|BS000666.1| Pan troglodytes chromosome Y clone:PTBY-003G06, ... 40 4.1
58gb|AC092924.7| Homo sapiens 3 BAC RP11-788A4 (Roswell Park Cance... 40 4.1
59gb|AC073655.26| Homo sapiens 12 BAC RP11-1105G2 (Roswell Park Ca... 40 4.1
60gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 4.1
61dbj|AK128197.1| Homo sapiens cDNA FLJ46325 fis, clone TESTI4043371 40 4.1
62gb|AC108116.2| Homo sapiens chromosome 5 clone RP11-318B23, comp... 40 4.1
63gb|AC008400.5| Homo sapiens chromosome 5 clone CTC-264D2, comple... 40 4.1
64gb|AC107877.4| Homo sapiens chromosome 8, clone RP11-74P9, compl... 40 4.1
65gb|AC010242.7| Homo sapiens chromosome 5 clone CTC-359E10, compl... 40 4.1
66gb|AC067854.14| Homo sapiens chromosome 8, clone RP11-513H8, com... 40 4.1
67gb|AC112183.3| Homo sapiens chromosome 5 clone RP11-152F4, compl... 40 4.1
68gb|AC074132.5| Homo sapiens chromosome 5 clone CTD-2266L18, comp... 40 4.1
69gb|AC107992.3| Homo sapiens chromosome 15, clone RP11-150L8, com... 40 4.1
70gb|AC087240.17| Homo sapiens 12p BAC RP11-752F20 (Roswell Park C... 40 4.1
71gb|AC091805.16| Homo sapiens 12p BAC RP11-841C19 (Roswell Park C... 40 4.1
72gb|AC078983.17| Homo sapiens 12q BAC RP11-473M14 (Roswell Park C... 40 4.1
73gb|AC008133.7| Homo sapiens chromosome 17, clone RP11-40A13, com... 40 4.1
74gb|AC091829.2| Homo sapiens chromosome 5 clone CTD-2021O22, comp... 40 4.1
75gb|AF238375.3| Homo sapiens chromosome 21 clone BAC 49B5 map 21q... 40 4.1
76gb|AC090919.6| Homo sapiens chromosome 8, clone RP11-42C24, comp... 40 4.1
77gb|AC011092.4| Homo sapiens, clone RP11-1H15, complete sequence 40 4.1
78gb|AC008703.6| Homo sapiens chromosome 5 clone CTB-76P12, comple... 40 4.1
79gb|AC090200.4| Homo sapiens chromosome 8, clone RP11-628E19, com... 40 4.1
80ref|XM_939565.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 4.1
81ref|XM_937797.1| PREDICTED: Homo sapiens similar to SET domain a... 40 4.1
82ref|XM_928538.1| PREDICTED: Homo sapiens hypothetical protein LO... 40 4.1
83ref|XM_928074.1| PREDICTED: Homo sapiens similar to SET domain a... 40 4.1
84gb|AC025898.10| Homo sapiens chromosome 17, clone RP11-421O15, c... 40 4.1
85gb|AC021914.7| Homo sapiens chromosome 11, clone RP11-68C8, comp... 40 4.1
86gb|CP000123.1| Mycoplasma capricolum subsp. capricolum ATCC 2734... 40 4.1
87gb|DP000004.1| Lemur catta target 1 genomic scaffold 40 4.1
88gb|AC160636.2| Mus musculus BAC clone RP23-364M15 from chromosom... 40 4.1
89gb|AC008816.8| Homo sapiens chromosome 5 clone CTD-2122K17, comp... 40 4.1
90gb|AC008571.6| Homo sapiens chromosome 5 clone CTC-550M4, comple... 40 4.1
91gb|AC017093.3|AC017093 Homo sapiens BAC clone RP11-511G7 from 5,... 40 4.1
92gb|AC022740.4|AC022740 Homo sapiens chromosome 15, clone RP11-61... 40 4.1
93gb|AC034215.4|AC034215 Homo sapiens chromosome 5 clone CTD-2001K... 40 4.1
94gb|AC126425.2| Lemur catta, clone -162D1, complete sequence 40 4.1
95gb|AC131599.2| Lemur catta, clone -206F2, complete sequence 40 4.1
96gb|AC080007.26| Homo sapiens 3 BAC RP11-529F4 (Roswell Park Canc... 40 4.1
97gb|AC093721.3| Homo sapiens BAC clone CTD-2010B10 from 4, comple... 40 4.1
98gb|AC104596.4| Homo sapiens BAC clone RP11-54P19 from 4, complet... 40 4.1
99gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold 40 4.1
100gb|AC010105.12| Homo sapiens BAC clone RP11-563E24 from 2, compl... 40 4.1
101gb|AC020941.5| Homo sapiens chromosome 5 clone CTD-2312I9, compl... 40 4.1
102gb|AC078824.13| Homo sapiens 12 BAC RP11-542B15 (Roswell Park Ca... 40 4.1
103gb|AC136352.10| Homo sapiens chromosome 15, clone RP11-116P24, c... 40 4.1
104gb|AC012414.12| Homo sapiens chromosome 15, clone RP11-403B2, co... 40 4.1
105gb|AC020553.4|AC020553 Homo sapiens BAC clone RP11-462D9 from 8,... 40 4.1
106gb|AC009483.3|AC009483 Homo sapiens BAC clone RP11-303H5 from 2,... 40 4.1
107gb|AC073062.7| Homo sapiens BAC clone RP11-132H1 from 2, complet... 40 4.1
108gb|AC078988.18| Homo sapiens X BAC RP11-169J21 (Roswell Park Can... 40 4.1
109gb|AC004819.2| Homo sapiens PAC clone RP1-15I23 from 22, complet... 40 4.1
110gb|AC104035.6| Homo sapiens chromosome 15, clone RP11-661P17, co... 40 4.1
111gb|AC123971.3| Lemur catta clone LB2-255J23, complete sequence 40 4.1
112gb|AC026355.13| Homo sapiens 3 BAC RP11-114M1 (Roswell Park Canc... 40 4.1
113gb|AC012443.8| Homo sapiens BAC clone RP11-17G11 from 2, complet... 40 4.1
114gb|AC109182.14| Mus musculus chromosome 7, clone RP23-223O9, com... 40 4.1
115gb|AY048455.1| Terrisswalkerius moritzi 12S ribosomal RNA gene, ... 40 4.1
116gb|AC008408.5|AC008408 Homo sapiens chromosome 5 clone CTC-278H1... 40 4.1
117gb|AC011422.2|AC011422 Homo sapiens chromosome 5 clone CTD-2335E... 40 4.1
118gb|AC008967.3|AC008967 Homo sapiens chromosome 5 clone CTD-2367A... 40 4.1
119dbj|BS000222.1| Pan troglodytes chromosome 22 clone:RP43-111J12,... 40 4.1
120dbj|BS000057.1| Pan troglodytes chromosome 22 clone:RP43-020J03,... 40 4.1
121dbj|AK130778.1| Homo sapiens cDNA FLJ27268 fis, clone TMS00396 40 4.1
122gb|AC004993.1|AC004993 Homo sapiens PAC clone RP5-1194E14 from 7... 40 4.1
123emb|AL163246.2|HS21C046 Homo sapiens chromosome 21 segment HS21C046 40 4.1
124gb|AC007198.6|AC007198 Homo sapiens, clone 18_A_13, complete seq... 40 4.1
125emb|AL096821.3|CNS00YVG Human chromosome 14 DNA sequence BAC R-6... 40 4.1
126emb|AL132719.4|CNS01DTH Human chromosome 14 DNA sequence BAC R-1... 40 4.1
127emb|AL357095.4|CNS05TDU Human chromosome 14 DNA sequence BAC R-4... 40 4.1
128dbj|AP001677.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 4.1
129gb|AC003106.1|AC003106 Homo sapiens Xp22 GS-524I1 (Genome System... 40 4.1
130dbj|AP004710.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 4.1
131dbj|AP005364.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 4.1
132emb|CT485606.7| Mouse DNA sequence from clone RP24-246F10 on chr... 40 4.1
133gb|CP000217.1| Drosophila melanogaster genomic scaffold 21100002... 40 4.1
134gb|CP000198.1| Drosophila melanogaster genomic scaffold 21100002... 40 4.1
135gb|AC004677.1|AC004677 Homo Sapiens Chromosome X clone bWXD501, ... 40 4.1
136dbj|AP005242.2| Homo sapiens genomic DNA, chromosome 18 clone:RP... 40 4.1
137gb|DP000022.1| Microcebus murinus target 1 genomic scaffold 40 4.1
138emb|AJ006995.1|HSF18108 Homo sapiens chromosome 21 PAC LLNLP704F... 40 4.1
139dbj|AP001256.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 4.1

>gb|AC129324.4| Mus musculus BAC clone RP23-253G24 from chromosome 18, complete
             sequence
          Length = 166990

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 18    aaatctgatatgatgcacaacata 41
             ||||||||||||||||||||||||
Sbjct: 35810 aaatctgatatgatgcacaacata 35833



to top

>gb|U66061.1| Human germline T-cell receptor beta chain TCRBV17S1A1T, TCRBV2S1,
             TCRBV10S1P, TCRBV29S1P, TCRBV19S1P, TCRBV15S1,
             TCRBV11S1A1T, HVB relic, TCRBV28S1P, TCRBV34S1, TCRBV14S1,
             TCRBV3S1, TCRBV4S1A1T, TRY4, TRY5, TRY6, TRY7, TRY8,
             TCRBD1, TCRBJ1S1, TCRBJ1S2, TCRBJ1S3, TCRBJ1S4, TCRBJ1S5,
             TCRBJ1S6, TCRBC1, TCRBD2, TCRBJ2S1, TCRBJ2S2, TCRBJ2S3,
             TCRBJ2S4, TCRBJ2S5, TCRBJ2S6, TCRBJ2S7, TCRBC2,
             TCRBV20S1A1N2 genes from bases 452324 to 684973 (section 3
             of 3)
          Length = 232650

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 254   tgcagggaaaatgcttccactgcca 278
             |||||||||||||||||||| ||||
Sbjct: 44971 tgcagggaaaatgcttccacagcca 44995



to top

>ref|NG_001333.1| Homo sapiens T cell receptor beta locus (TRB@) on chromosome 7
          Length = 684973

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 254    tgcagggaaaatgcttccactgcca 278
              |||||||||||||||||||| ||||
Sbjct: 497294 tgcagggaaaatgcttccacagcca 497318



to top

>gb|AC146433.3| Pan troglodytes BAC clone RP43-19C19 from 7, complete sequence
          Length = 180951

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 254   tgcagggaaaatgcttccactgcca 278
             |||||||||||||||||||| ||||
Sbjct: 44935 tgcagggaaaatgcttccacagcca 44959



to top

>gb|AC124405.4| Mus musculus BAC clone RP24-372I6 from chromosome 6, complete sequence
          Length = 153417

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 49    ttttatttattcttacataaa 69
             |||||||||||||||||||||
Sbjct: 32921 ttttatttattcttacataaa 32941



to top

>gb|AF029308.1|HTCRBCHR9 Homo sapiens chromosome 9 duplication of the T cell receptor beta locus
             and trypsinogen gene families
          Length = 216293

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 254   tgcagggaaaatgcttccactgcca 278
             |||||||||||||||||||| ||||
Sbjct: 48681 tgcagggaaaatgcttccacagcca 48705



to top

>emb|AL356489.14| Human DNA sequence from clone RP11-384P7 on chromosome 9 Contains
           the TRBV25OR9-2 gene for T cell receptor beta variable
           25/OR9-2, the PTENP1 gene for phosphatase and tensin
           homolog (mutated in multiple advanced cancers 1)
           pseudogene 1 (PTH2, PTEN2, PSIPTEN), a T-cell receptor
           beta chain V region protein pseudogene, two novel genes,
           the 5' end of the PRSS3 gene for serine protease 3
           (mesotrypsin) and two CpG islands, complete sequence
          Length = 130639

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 254 tgcagggaaaatgcttccactgcca 278
           |||||||||||||||||||| ||||
Sbjct: 36  tgcagggaaaatgcttccacagcca 60



to top

>gb|AC091770.5| Homo sapiens BAC clone RP11-655M5 from 7, complete sequence
          Length = 93543

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 254  tgcagggaaaatgcttccactgcca 278
            |||||||||||||||||||| ||||
Sbjct: 4432 tgcagggaaaatgcttccacagcca 4456



to top

>gb|AC148347.13| Medicago truncatula clone mth2-26g24, complete sequence
          Length = 114712

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 41    acaaaaacttttatttattct 61
             |||||||||||||||||||||
Sbjct: 90904 acaaaaacttttatttattct 90884



to top

>gb|AF491780.1| Homo sapiens neuregulin 1 (NRG1) gene, partial cds, alternatively spliced
          Length = 1285452

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 253    ctgcagggaaaatgcttccac 273
              |||||||||||||||||||||
Sbjct: 463807 ctgcagggaaaatgcttccac 463827



to top

>emb|AL139008.10| Human DNA sequence from clone RP11-255A11 on chromosome 9 Contains four
              novel genes, the gene for a novel protein similar to
              suppressor of G2 allele of SKP1 homolog, the gene for a
              novel protein similar to KIAA1074, a melanoma antigen
              pseudogene, a sorting nexin 18 (SNX18) pseudogene, a
              trypsin domain pseudogene, two genes for novel
              immunoglobulin domain containing proteins, the gene for a
              novel protein similar to annexin A2 (ANXA2), the gene for a
              novel protein similar to T-cell receptor beta chain V
              region proteins, a T-cell receptor beta chain V region
              protein LB2 pseudogene and two CpG islands, complete
              sequence
          Length = 159974

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 254    tgcagggaaaatgcttccactgcca 278
              |||||||||||||||||||| ||||
Sbjct: 159910 tgcagggaaaatgcttccacagcca 159934



to top

>emb|AL023913.6|HS1068F16 Human DNA sequence from clone RP5-1068F16 on chromosome 20p12 Contains
              the 3' end of the SNAP25 gene for 25kDa
              synaptosomal-associated protein, the RPL23AP6 gene for
              ribosomal protein L23a pseudogene 6, part of a novel gene
              and a hypoxia induced gene 1 (HIG1) pseudogene, complete
              sequence
          Length = 140306

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 254    tgcagggaaaatgcttccact 274
              |||||||||||||||||||||
Sbjct: 137937 tgcagggaaaatgcttccact 137957



to top

>emb|AJ493124.1|VDE493124 Varroa destructor complete mitochondrial genome
          Length = 16477

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 43    aaaaacttttatttattctta 63
             |||||||||||||||||||||
Sbjct: 12898 aaaaacttttatttattctta 12878



to top

>ref|NG_001337.1| Homo sapiens T cell receptor beta variable orphans on chromosome 9
             (TRBVOR9@) on chromosome 9
          Length = 194564

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 254   tgcagggaaaatgcttccactgcca 278
             |||||||||||||||||||| ||||
Sbjct: 48636 tgcagggaaaatgcttccacagcca 48660



to top

>gb|AC148525.14| Medicago truncatula clone mth2-24i13, complete sequence
          Length = 94953

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 41    acaaaaacttttatttattct 61
             |||||||||||||||||||||
Sbjct: 75821 acaaaaacttttatttattct 75841



to top

>gb|AC022833.5| Homo sapiens chromosome , clone RP11-147C21, complete sequence
          Length = 177019

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 253    ctgcagggaaaatgcttccac 273
              |||||||||||||||||||||
Sbjct: 157363 ctgcagggaaaatgcttccac 157343



to top

>gb|AC016583.8| Homo sapiens chromosome 5 clone CTD-2591A1, complete sequence
          Length = 184769

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 165   aatttgccttcagaggtaaca 185
             |||||||||||||||||||||
Sbjct: 56424 aatttgccttcagaggtaaca 56444



to top

>tpg|BK000383.1| TPA: TPA_exp: Homo sapiens neuregulin 1 isoform (NRG1) gene,
              alternatively spliced, complete cds
          Length = 1421559

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 253    ctgcagggaaaatgcttccac 273
              |||||||||||||||||||||
Sbjct: 463807 ctgcagggaaaatgcttccac 463827



to top

>gb|AY163547.1| Varroa destructor mitochondrion, complete genome
          Length = 15277

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 43    aaaaacttttatttattctta 63
             |||||||||||||||||||||
Sbjct: 12970 aaaaacttttatttattctta 12950



to top

>gb|DP000017.1| Sus scrofa target 1 genomic scaffold
          Length = 1471440

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 44     aaaacttttatttattcttacata 67
              |||||||||||||||| |||||||
Sbjct: 476991 aaaacttttatttatttttacata 477014



to top

>gb|AC091263.15| Mus musculus chromosome 9, clone RP23-134F1, complete sequence
          Length = 204289

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    atatgatgcacaacatacaa 44
             ||||||||||||||||||||
Sbjct: 10381 atatgatgcacaacatacaa 10400



to top

>gb|AC150687.3| Bos taurus  BAC CH240-243M2 (Children's Hospital Oakland Research
            Institute Bovine BAC Library (male)) complete sequence
          Length = 144223

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  tgcagggaaaatgcttccac 273
            ||||||||||||||||||||
Sbjct: 1391 tgcagggaaaatgcttccac 1372



to top

>gb|AC149774.2| Bos taurus  BAC CH240-10G15 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 186916

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 15944 tgcagggaaaatgcttccac 15963



to top

>gb|AC158704.3| Microcebus murinus clone CH257-434D18, complete sequence
          Length = 257333

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 28851 tgcagggaaaatgcttccac 28870



to top

>gb|AC087423.2| Sus scrofa clone RP44-55G2, complete sequence
          Length = 150305

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 44    aaaacttttatttattcttacata 67
             |||||||||||||||| |||||||
Sbjct: 98991 aaaacttttatttatttttacata 99014



to top

>gb|AC146263.2| Pan troglodytes BAC clone RP43-28O1 from 7, complete sequence
          Length = 141252

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 91865 tgcagggaaaatgcttccac 91884



to top

>gb|AC147343.2| Pan troglodytes BAC clone CH251-14P15 from Y, complete sequence
          Length = 277007

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 116249 tgcagggaaaatgcttccac 116230



to top

>gb|AC147117.2| Pan troglodytes BAC clone CH251-532B3 from Y, complete sequence
          Length = 207020

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 64490 tgcagggaaaatgcttccac 64509



to top

>ref|XM_719404.1| Plasmodium yoelii yoelii str. 17XNL insulinase (PY04232) partial
          mRNA
          Length = 3810

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 49 ttttatttattcttacataa 68
          ||||||||||||||||||||
Sbjct: 31 ttttatttattcttacataa 12



to top

>gb|AE004392.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome II, section 49
             of 93 of the complete chromosome
          Length = 12031

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 54    tttattcttacataaatcca 73
             ||||||||||||||||||||
Sbjct: 11557 tttattcttacataaatcca 11538



to top

>ref|XM_739172.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000480.04.0)
          partial mRNA
          Length = 3651

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 49 ttttatttattcttacataa 68
          ||||||||||||||||||||
Sbjct: 31 ttttatttattcttacataa 12



to top

>gb|AC098592.5| Homo sapiens BAC clone RP11-403N12 from 7, complete sequence
          Length = 190672

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 98358 tgcagggaaaatgcttccac 98377



to top

>gb|AC006148.3| Homo sapiens PAC clone RP5-902E20 from 7, complete sequence
          Length = 121110

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 107808 tgcagggaaaatgcttccac 107789



to top

>gb|AC146057.2| Pan troglodytes BAC clone RP43-90E18 from 7, complete sequence
          Length = 210447

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 108581 tgcagggaaaatgcttccac 108562



to top

>emb|Z99129.1|HS425C14 Human DNA sequence from clone RP3-425C14 on chromosome 6q22 Contains the
              3' end of the HSF2 gene for  Heat Shock Transcription
              Factor 2 and the 3' end of a novel gene for KIAA1253
              protein (similar to tumor differentially expressed TDE1),
              complete sequence
          Length = 160203

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 118130 tgcagggaaaatgcttccac 118111



to top

>emb|AL646087.8| Human DNA sequence from clone RP11-412K4 on chromosome 13 Contians
            the 3' end of the gene for osteoblast specific factor 2
            (fasciclin I-like) (OSF-2), complete sequence
          Length = 42319

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  tgcagggaaaatgcttccac 273
            ||||||||||||||||||||
Sbjct: 3858 tgcagggaaaatgcttccac 3839



to top

>emb|AL592466.9| Human DNA sequence from clone RP11-428G2 on chromosome 10 Contains a
             novel gene, complete sequence
          Length = 113271

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 82182 tgcagggaaaatgcttccac 82163



to top

>emb|AL592227.4| Human DNA sequence from clone RP11-32D4 on chromosome 9 Contains a CpG
             island, complete sequence
          Length = 55535

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 14928 tgcagggaaaatgcttccac 14909



to top

>emb|AL450472.14| Human DNA sequence from clone RP11-265D19 on chromosome X Contains the 5'
              end of the ZNF75 gene for zinc finger protein 75 (D8C6),
              gene FLJ23614, two novel genes, the 5' end of a novel gene,
              a novel pseudogene and four CpG islands, complete sequence
          Length = 177877

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 140166 tgcagggaaaatgcttccac 140147



to top

>emb|AL359979.10| Human DNA sequence from clone RP11-239E10 on chromosome 1 Contains the
             5' end of the TLR5 gene for toll-like receptor 5, two
             novel genes, the gene for a novel protein (FLJ10052) and a
             CpG island, complete sequence
          Length = 181466

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 70905 tgcagggaaaatgcttccac 70886



to top

>emb|AL359771.27| Human DNA sequence from clone CTA-520D8 on chromosome 1 Contains the 3'
             end of the gene for lung type-I cell membrane-associated
             glycoprotein (T1A-2), a novel gene, the 5' end of the
             PRDM2 gene for PR domain containing 2 with ZNF domain and
             a CpG island, complete sequence
          Length = 111182

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 38345 tgcagggaaaatgcttccac 38326



to top

>emb|AL355586.27| Human DNA sequence from clone RP11-59I9 on chromosome 6q16.3-21
             Contains two novel genes, the 3' end of the C6orf210 gene
             for chromosome 6 open reading frame 210 and three CpG
             islands, complete sequence
          Length = 185311

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 21766 tgcagggaaaatgcttccac 21785



to top

>emb|AL355303.16| Human DNA sequence from clone RP11-445P17 on chromosome 10 Contains the
             5' end of the gene for a novel protein similar to
             aldo-keto reductase, the AKR1C4 gene for aldo-keto
             reductase family 1 member C4, a novel gene, an aldo-keto
             reductase pseudogene, a ribosomal protein L26 (RPL26)
             pseudogene, an ADP-ribosylation factor-like 4 (ARL4)
             pseudogene,. a novel gene and a CpG island, complete
             sequence
          Length = 145692

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 81035 tgcagggaaaatgcttccac 81054



to top

>emb|AL356534.12| Human DNA sequence from clone RP11-629P13 on chromosome 6, complete
              sequence
          Length = 175757

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 156700 tgcagggaaaatgcttccac 156681



to top

>emb|AL355516.12| Human DNA sequence from clone RP11-442J17 on chromosome 13 Contains a
            KIAA0254 gene product pseudogene, two novel genes, a PHD
            finger protein 2 (PHF2) (GRC5) pseudogene and a CpG
            island, complete sequence
          Length = 93925

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 254  tgcagggaaaatgcttccac 273
            ||||||||||||||||||||
Sbjct: 1558 tgcagggaaaatgcttccac 1577



to top

>emb|AL355607.10| Human DNA sequence from clone RP11-367F23 on chromosome 9 Contains a
             novel gene, complete sequence
          Length = 113308

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 11584 tgcagggaaaatgcttccac 11565



to top

>emb|AL162596.30| Human DNA sequence from clone RP1-13P20 on chromosome 1q21.1-21.3
             Contains the SPRL2A gene for small proline rich-like
             (epidermal differentiation complex) 2A, the LEP1 gene for
             late envelope protein 1, a novel gene, the MCSP gene for
             mitochondrial capsule selenoprotein and the IVL gene for
             involucrin, complete sequence
          Length = 116067

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 88382 tgcagggaaaatgcttccac 88363



to top

>gb|AC105275.3| Homo sapiens chromosome 1 clone RP11-359E8, complete sequence
          Length = 164736

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 94321 tgcagggaaaatgcttccac 94340



to top

>emb|AL158218.11| Human DNA sequence from clone RP5-831K15 on chromosome 1p31.1-31.3
             Contains a ribosomal protein L7 (RPL7) pseudogene,
             complete sequence
          Length = 103186

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 33182 tgcagggaaaatgcttccac 33163



to top

>emb|AL157828.14| Human DNA sequence from clone RP11-214I20 on chromosome 9p22.3-24
             Contains the 5' end of a novel gene and the 3' end of a
             novel gene (FLJ38505 FLJ90271), complete sequence
          Length = 100927

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 46281 tgcagggaaaatgcttccac 46262



to top

>gb|AC090571.5| Homo sapiens chromosome 8, clone RP11-313J18, complete sequence
          Length = 218627

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 154971 tgcagggaaaatgcttccac 154990



to top

>gb|AC105180.8| Homo sapiens chromosome 8, clone RP11-345J1, complete sequence
          Length = 174617

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 171195 tgcagggaaaatgcttccac 171214



to top

>gb|AC068446.22| Homo sapiens chromosome 15, clone RP11-32B5, complete sequence
          Length = 158465

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 88567 tgcagggaaaatgcttccac 88548



to top

>emb|AL033530.1|HS629A15 Human DNA sequence from clone RP4-629A15 on chromosome 1p31.1-31.3
             Contains EST, complete sequence
          Length = 93643

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 11217 tgcagggaaaatgcttccac 11236



to top

>gb|AC021580.9| Homo sapiens chromosome 9, clone RP11-1091N2, complete sequence
          Length = 210557

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 63338 tgcagggaaaatgcttccac 63319



to top

>gb|AC015528.14| Homo sapiens chromosome 8, clone RP11-179A23, complete sequence
          Length = 155518

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 50    tttatttattcttacataaa 69
             ||||||||||||||||||||
Sbjct: 71999 tttatttattcttacataaa 71980



to top

>dbj|BS000666.1| Pan troglodytes chromosome Y clone:PTBY-003G06, complete sequences
          Length = 102559

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 51643 tgcagggaaaatgcttccac 51662



to top

>gb|AC092924.7| Homo sapiens 3 BAC RP11-788A4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 155417

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 58241 tgcagggaaaatgcttccac 58260



to top

>gb|AC073655.26| Homo sapiens 12 BAC RP11-1105G2 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 188105

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 107906 tgcagggaaaatgcttccac 107925



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 185268 tgcagggaaaatgcttccac 185249



to top

>dbj|AK128197.1| Homo sapiens cDNA FLJ46325 fis, clone TESTI4043371
          Length = 4250

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  tgcagggaaaatgcttccac 273
            ||||||||||||||||||||
Sbjct: 2498 tgcagggaaaatgcttccac 2479



to top

>gb|AC108116.2| Homo sapiens chromosome 5 clone RP11-318B23, complete sequence
          Length = 203171

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 72615 tgcagggaaaatgcttccac 72634



to top

>gb|AC008400.5| Homo sapiens chromosome 5 clone CTC-264D2, complete sequence
          Length = 117409

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 59071 tgcagggaaaatgcttccac 59052



to top

>gb|AC107877.4| Homo sapiens chromosome 8, clone RP11-74P9, complete sequence
          Length = 181925

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 128002 tgcagggaaaatgcttccac 127983



to top

>gb|AC010242.7| Homo sapiens chromosome 5 clone CTC-359E10, complete sequence
          Length = 174293

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 107145 tgcagggaaaatgcttccac 107164



to top

>gb|AC067854.14| Homo sapiens chromosome 8, clone RP11-513H8, complete sequence
          Length = 203982

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 53897 tgcagggaaaatgcttccac 53916



to top

>gb|AC112183.3| Homo sapiens chromosome 5 clone RP11-152F4, complete sequence
          Length = 163612

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 115424 tgcagggaaaatgcttccac 115443



to top

>gb|AC074132.5| Homo sapiens chromosome 5 clone CTD-2266L18, complete sequence
          Length = 118131

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 30980 tgcagggaaaatgcttccac 30961



to top

>gb|AC107992.3| Homo sapiens chromosome 15, clone RP11-150L8, complete sequence
          Length = 149015

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  tgcagggaaaatgcttccac 273
            ||||||||||||||||||||
Sbjct: 8398 tgcagggaaaatgcttccac 8379



to top

>gb|AC087240.17| Homo sapiens 12p BAC RP11-752F20 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 198068

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 23148 tgcagggaaaatgcttccac 23129



to top

>gb|AC091805.16| Homo sapiens 12p BAC RP11-841C19 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 177115

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 193   tgcagtaaatacaaaaatgt 212
             ||||||||||||||||||||
Sbjct: 74609 tgcagtaaatacaaaaatgt 74590



to top

>gb|AC078983.17| Homo sapiens 12q BAC RP11-473M14 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 163613

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 36621 tgcagggaaaatgcttccac 36602



to top

>gb|AC008133.7| Homo sapiens chromosome 17, clone RP11-40A13, complete sequence
          Length = 179744

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 119924 tgcagggaaaatgcttccac 119943



to top

>gb|AC091829.2| Homo sapiens chromosome 5 clone CTD-2021O22, complete sequence
          Length = 92702

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 81424 tgcagggaaaatgcttccac 81443



to top

>gb|AF238375.3| Homo sapiens chromosome 21 clone BAC 49B5 map 21q21, complete sequence
          Length = 166124

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 148785 tgcagggaaaatgcttccac 148804



to top

>gb|AC090919.6| Homo sapiens chromosome 8, clone RP11-42C24, complete sequence
          Length = 184897

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 111893 tgcagggaaaatgcttccac 111874



to top

>gb|AC011092.4| Homo sapiens, clone RP11-1H15, complete sequence
          Length = 192318

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 128427 tgcagggaaaatgcttccac 128408



to top

>gb|AC008703.6| Homo sapiens chromosome 5 clone CTB-76P12, complete sequence
          Length = 214187

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 203044 tgcagggaaaatgcttccac 203025



to top

>gb|AC090200.4| Homo sapiens chromosome 8, clone RP11-628E19, complete sequence
          Length = 149955

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 76926 tgcagggaaaatgcttccac 76945



to top

>ref|XM_939565.1| PREDICTED: Homo sapiens hypothetical protein LOC648469 (LOC648469),
           mRNA
          Length = 2415

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 tgcagggaaaatgcttccac 273
           ||||||||||||||||||||
Sbjct: 186 tgcagggaaaatgcttccac 167



to top

>ref|XM_937797.1| PREDICTED: Homo sapiens similar to SET domain and mariner
           transposase fusion gene (LOC648711), mRNA
          Length = 1014

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 254 tgcagggaaaatgcttccac 273
           ||||||||||||||||||||
Sbjct: 422 tgcagggaaaatgcttccac 441



to top

>ref|XM_928538.1| PREDICTED: Homo sapiens hypothetical protein LOC643608 (LOC643608),
           mRNA
          Length = 2415

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 tgcagggaaaatgcttccac 273
           ||||||||||||||||||||
Sbjct: 186 tgcagggaaaatgcttccac 167



to top

>ref|XM_928074.1| PREDICTED: Homo sapiens similar to SET domain and mariner
           transposase fusion gene (LOC645012), mRNA
          Length = 1014

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 254 tgcagggaaaatgcttccac 273
           ||||||||||||||||||||
Sbjct: 422 tgcagggaaaatgcttccac 441



to top

>gb|AC025898.10| Homo sapiens chromosome 17, clone RP11-421O15, complete sequence
          Length = 184875

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 21142 tgcagggaaaatgcttccac 21161



to top

>gb|AC021914.7| Homo sapiens chromosome 11, clone RP11-68C8, complete sequence
          Length = 156507

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 222   tacatataatttgacttcag 241
             ||||||||||||||||||||
Sbjct: 17979 tacatataatttgacttcag 17998



to top

>gb|CP000123.1| Mycoplasma capricolum subsp. capricolum ATCC 27343, complete genome
          Length = 1010023

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 38     catacaaaaacttttattta 57
              ||||||||||||||||||||
Sbjct: 336276 catacaaaaacttttattta 336257



to top

>gb|DP000004.1| Lemur catta target 1 genomic scaffold
          Length = 1399362

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 254     tgcagggaaaatgcttccac 273
               ||||||||||||||||||||
Sbjct: 1254121 tgcagggaaaatgcttccac 1254140



to top

>gb|AC160636.2| Mus musculus BAC clone RP23-364M15 from chromosome 9, complete sequence
          Length = 139726

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    atatgatgcacaacatacaa 44
             ||||||||||||||||||||
Sbjct: 82549 atatgatgcacaacatacaa 82530



to top

>gb|AC008816.8| Homo sapiens chromosome 5 clone CTD-2122K17, complete sequence
          Length = 174293

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 107145 tgcagggaaaatgcttccac 107164



to top

>gb|AC008571.6| Homo sapiens chromosome 5 clone CTC-550M4, complete sequence
          Length = 214267

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 209242 tgcagggaaaatgcttccac 209223



to top

>gb|AC017093.3|AC017093 Homo sapiens BAC clone RP11-511G7 from 5, complete sequence
          Length = 203043

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 169482 tgcagggaaaatgcttccac 169501



to top

>gb|AC022740.4|AC022740 Homo sapiens chromosome 15, clone RP11-617D22, complete sequence
          Length = 162482

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 46642 tgcagggaaaatgcttccac 46623



to top

>gb|AC034215.4|AC034215 Homo sapiens chromosome 5 clone CTD-2001K4, complete sequence
          Length = 142116

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 254  tgcagggaaaatgcttccac 273
            ||||||||||||||||||||
Sbjct: 3607 tgcagggaaaatgcttccac 3626



to top

>gb|AC126425.2| Lemur catta, clone -162D1, complete sequence
          Length = 154718

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 114482 tgcagggaaaatgcttccac 114501



to top

>gb|AC131599.2| Lemur catta, clone -206F2, complete sequence
          Length = 155606

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  tgcagggaaaatgcttccac 273
            ||||||||||||||||||||
Sbjct: 3255 tgcagggaaaatgcttccac 3236



to top

>gb|AC080007.26| Homo sapiens 3 BAC RP11-529F4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 168551

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 58052 tgcagggaaaatgcttccac 58071



to top

>gb|AC093721.3| Homo sapiens BAC clone CTD-2010B10 from 4, complete sequence
          Length = 128148

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 37908 tgcagggaaaatgcttccac 37927



to top

>gb|AC104596.4| Homo sapiens BAC clone RP11-54P19 from 4, complete sequence
          Length = 168591

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 25586 tgcagggaaaatgcttccac 25567



to top

>gb|DP000024.1| Eulemur macaco macaco target 1 genomic scaffold
          Length = 1570569

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 254     tgcagggaaaatgcttccac 273
               ||||||||||||||||||||
Sbjct: 1323682 tgcagggaaaatgcttccac 1323701



to top

>gb|AC010105.12| Homo sapiens BAC clone RP11-563E24 from 2, complete sequence
          Length = 193320

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 107584 tgcagggaaaatgcttccac 107603



to top

>gb|AC020941.5| Homo sapiens chromosome 5 clone CTD-2312I9, complete sequence
          Length = 171317

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 120213 tgcagggaaaatgcttccac 120194



to top

>gb|AC078824.13| Homo sapiens 12 BAC RP11-542B15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 173697

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 148751 tgcagggaaaatgcttccac 148732



to top

>gb|AC136352.10| Homo sapiens chromosome 15, clone RP11-116P24, complete sequence
          Length = 177255

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 138137 tgcagggaaaatgcttccac 138118



to top

>gb|AC012414.12| Homo sapiens chromosome 15, clone RP11-403B2, complete sequence
          Length = 162400

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 149208 tgcagggaaaatgcttccac 149189



to top

>gb|AC020553.4|AC020553 Homo sapiens BAC clone RP11-462D9 from 8, complete sequence
          Length = 160811

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 73004 tgcagggaaaatgcttccac 73023



to top

>gb|AC009483.3|AC009483 Homo sapiens BAC clone RP11-303H5 from 2, complete sequence
          Length = 206589

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 254  tgcagggaaaatgcttccac 273
            ||||||||||||||||||||
Sbjct: 5353 tgcagggaaaatgcttccac 5372



to top

>gb|AC073062.7| Homo sapiens BAC clone RP11-132H1 from 2, complete sequence
          Length = 135822

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 37884 tgcagggaaaatgcttccac 37865



to top

>gb|AC078988.18| Homo sapiens X BAC RP11-169J21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 169849

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 95358 tgcagggaaaatgcttccac 95377



to top

>gb|AC004819.2| Homo sapiens PAC clone RP1-15I23 from 22, complete sequence
          Length = 59113

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 34773 tgcagggaaaatgcttccac 34754



to top

>gb|AC104035.6| Homo sapiens chromosome 15, clone RP11-661P17, complete sequence
          Length = 200370

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 159246 tgcagggaaaatgcttccac 159227



to top

>gb|AC123971.3| Lemur catta clone LB2-255J23, complete sequence
          Length = 222919

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 77678 tgcagggaaaatgcttccac 77697



to top

>gb|AC026355.13| Homo sapiens 3 BAC RP11-114M1 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 157439

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 143760 tgcagggaaaatgcttccac 143741



to top

>gb|AC012443.8| Homo sapiens BAC clone RP11-17G11 from 2, complete sequence
          Length = 153610

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 109280 tgcagggaaaatgcttccac 109261



to top

>gb|AC109182.14| Mus musculus chromosome 7, clone RP23-223O9, complete sequence
          Length = 191479

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 45     aaacttttatttattcttac 64
              ||||||||||||||||||||
Sbjct: 152779 aaacttttatttattcttac 152798



to top

>gb|AY048455.1| Terrisswalkerius moritzi 12S ribosomal RNA gene, partial sequence;
           mitochondrial gene for mitochondrial product
          Length = 354

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 76  aaagtggacttgaatgtaat 95
           ||||||||||||||||||||
Sbjct: 280 aaagtggacttgaatgtaat 299



to top

>gb|AC008408.5|AC008408 Homo sapiens chromosome 5 clone CTC-278H1, complete sequence
          Length = 78877

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 254  tgcagggaaaatgcttccac 273
            ||||||||||||||||||||
Sbjct: 5798 tgcagggaaaatgcttccac 5817



to top

>gb|AC011422.2|AC011422 Homo sapiens chromosome 5 clone CTD-2335E17, complete sequence
          Length = 119668

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 254 tgcagggaaaatgcttccac 273
           ||||||||||||||||||||
Sbjct: 326 tgcagggaaaatgcttccac 345



to top

>gb|AC008967.3|AC008967 Homo sapiens chromosome 5 clone CTD-2367A17, complete sequence
          Length = 88958

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 29431 tgcagggaaaatgcttccac 29412



to top

>dbj|BS000222.1| Pan troglodytes chromosome 22 clone:RP43-111J12, map 22, complete
              sequences
          Length = 189474

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 172749 tgcagggaaaatgcttccac 172730



to top

>dbj|BS000057.1| Pan troglodytes chromosome 22 clone:RP43-020J03, map 22, complete
              sequences
          Length = 185342

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 144268 tgcagggaaaatgcttccac 144287



to top

>dbj|AK130778.1| Homo sapiens cDNA FLJ27268 fis, clone TMS00396
          Length = 2199

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 254 tgcagggaaaatgcttccac 273
           ||||||||||||||||||||
Sbjct: 191 tgcagggaaaatgcttccac 172



to top

>gb|AC004993.1|AC004993 Homo sapiens PAC clone RP5-1194E14 from 7p21, complete sequence
          Length = 161453

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 70266 tgcagggaaaatgcttccac 70247



to top

>emb|AL163246.2|HS21C046 Homo sapiens chromosome 21 segment HS21C046
          Length = 340000

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 26399 tgcagggaaaatgcttccac 26380



to top

>gb|AC007198.6|AC007198 Homo sapiens, clone 18_A_13, complete sequence
          Length = 166977

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 81535 tgcagggaaaatgcttccac 81554



to top

>emb|AL096821.3|CNS00YVG Human chromosome 14 DNA sequence BAC R-677J5 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 209111

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 14070 tgcagggaaaatgcttccac 14051



to top

>emb|AL132719.4|CNS01DTH Human chromosome 14 DNA sequence BAC R-1082A3 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 171505

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 165627 tgcagggaaaatgcttccac 165608



to top

>emb|AL357095.4|CNS05TDU Human chromosome 14 DNA sequence BAC R-48D2 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181805

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 96785 tgcagggaaaatgcttccac 96766



to top

>dbj|AP001677.1| Homo sapiens genomic DNA, chromosome 21q, section 21/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 336355 tgcagggaaaatgcttccac 336374



to top

>gb|AC003106.1|AC003106 Homo sapiens Xp22 GS-524I1 (Genome Systems Human BAC library), complete
             sequence
          Length = 128888

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 36111 tgcagggaaaatgcttccac 36092



to top

>dbj|AP004710.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1429D6, complete
            sequence
          Length = 179115

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 254  tgcagggaaaatgcttccac 273
            ||||||||||||||||||||
Sbjct: 1381 tgcagggaaaatgcttccac 1362



to top

>dbj|AP005364.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1970D8, complete
              sequence
          Length = 168850

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 149608 tgcagggaaaatgcttccac 149589



to top

>emb|CT485606.7| Mouse DNA sequence from clone RP24-246F10 on chromosome 9, complete
              sequence
          Length = 165446

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 192    ttgcagtaaatacaaaaatg 211
              ||||||||||||||||||||
Sbjct: 139309 ttgcagtaaatacaaaaatg 139328



to top

>gb|CP000217.1| Drosophila melanogaster genomic scaffold 211000022280770
          Length = 268584

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     cttttatttattcttacata 67
              ||||||||||||||||||||
Sbjct: 111338 cttttatttattcttacata 111319



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     cttttatttattcttacata 67
              ||||||||||||||||||||
Sbjct: 106621 cttttatttattcttacata 106602



 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    cttttatttattcttacata 67
             ||||||||||||||||||||
Sbjct: 99664 cttttatttattcttacata 99683



to top

>gb|CP000198.1| Drosophila melanogaster genomic scaffold 211000022280716
          Length = 133267

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 48     cttttatttattcttacata 67
              ||||||||||||||||||||
Sbjct: 123595 cttttatttattcttacata 123614



to top

>gb|AC004677.1|AC004677 Homo Sapiens Chromosome X clone bWXD501, complete sequence
          Length = 128559

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 254    tgcagggaaaatgcttccac 273
              ||||||||||||||||||||
Sbjct: 123287 tgcagggaaaatgcttccac 123268



to top

>dbj|AP005242.2| Homo sapiens genomic DNA, chromosome 18 clone:RP11-805F19, complete
             sequence
          Length = 196360

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 97843 tgcagggaaaatgcttccac 97862



to top

>gb|DP000022.1| Microcebus murinus target 1 genomic scaffold
          Length = 1595145

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 254     tgcagggaaaatgcttccac 273
               ||||||||||||||||||||
Sbjct: 1342303 tgcagggaaaatgcttccac 1342322



to top

>emb|AJ006995.1|HSF18108 Homo sapiens chromosome 21 PAC LLNLP704F18108Q13, complete sequence
          Length = 152383

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 23439 tgcagggaaaatgcttccac 23420



to top

>dbj|AP001256.2| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:B732H1,
             LL56-APP region, complete sequence
          Length = 204699

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   tgcagggaaaatgcttccac 273
             ||||||||||||||||||||
Sbjct: 80775 tgcagggaaaatgcttccac 80794


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,727,952
Number of Sequences: 3902068
Number of extensions: 4727952
Number of successful extensions: 83621
Number of sequences better than 10.0: 140
Number of HSP's better than 10.0 without gapping: 140
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83251
Number of HSP's gapped (non-prelim): 370
length of query: 310
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 288
effective length of database: 17,147,199,772
effective search space: 4938393534336
effective search space used: 4938393534336
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top