Clone Name | rbastl17e04 |
---|---|
Clone Library Name | barley_pub |
>gb|AE014852.2| Plasmodium falciparum 3D7 chromosome 12, section 9 of 9 of the complete sequence Length = 260929 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 110 aaagcaacaaacatagctgc 129 |||||||||||||||||||| Sbjct: 204833 aaagcaacaaacatagctgc 204852
>emb|AL392184.7| Human DNA sequence from clone RP3-382B1 on chromosome 6 Contains part of the gene for phenylalanine-tRNA synthetase (FARS1), complete sequence Length = 42892 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 254 caccaacaacagaaaaccct 273 |||||||||||||||||||| Sbjct: 7580 caccaacaacagaaaaccct 7561
>emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on chromosome 9 Contains part of the ASTN2 gene for astrotactin2 (KIAA0634), and a CpG island, complete sequence Length = 162575 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 38 cagagtgcagcccaagggcg 57 |||||||||||||||||||| Sbjct: 132033 cagagtgcagcccaagggcg 132014
>gb|AC156611.10| Mus musculus chromosome 5, clone RP23-163P2, complete sequence Length = 200155 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 gaaaaggtaaaagcaacaaa 120 |||||||||||||||||||| Sbjct: 154534 gaaaaggtaaaagcaacaaa 154515
>emb|BX324004.6| Zebrafish DNA sequence from clone CH211-284O17 in linkage group 12, complete sequence Length = 136645 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 239 taggtggggcaatggcacca 258 |||||||||||||||||||| Sbjct: 52065 taggtggggcaatggcacca 52084
>dbj|AK140922.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130072C02 product:unclassifiable, full insert sequence Length = 4219 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 103 aaaggtaaaagcaacaaaca 122 |||||||||||||||||||| Sbjct: 3333 aaaggtaaaagcaacaaaca 3314
>gb|AC171007.3| Gallus gallus BAC clone CH261-166I11 from chromosome ul, complete sequence Length = 223327 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 9 caaccactctcagtttttac 28 |||||||||||||||||||| Sbjct: 160161 caaccactctcagtttttac 160142
>gb|AC090950.3| Homo sapiens chromosome 3 clone RP11-44D5 map 3p, complete sequence Length = 199288 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 107 gtaaaagcaacaaacatagc 126 |||||||||||||||||||| Sbjct: 148821 gtaaaagcaacaaacatagc 148840
>dbj|AK090011.1| Mus musculus RCB-0464 Meth-A cDNA, RIKEN full-length enriched library, clone:G430059M05 product:RIKEN cDNA 2010110K24 gene, full insert sequence Length = 1597 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 103 aaaggtaaaagcaacaaaca 122 |||||||||||||||||||| Sbjct: 1467 aaaggtaaaagcaacaaaca 1448
>gb|AC148019.5| Mus musculus BAC clone RP23-12B6 from chromosome 18, complete sequence Length = 211149 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 179 ctaatttctgtccaaagtca 198 |||||||||||||||||||| Sbjct: 127159 ctaatttctgtccaaagtca 127140
>emb|AL954339.10| Zebrafish DNA sequence from clone CH211-221J21 in linkage group 12, complete sequence Length = 203958 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 239 taggtggggcaatggcacca 258 |||||||||||||||||||| Sbjct: 152628 taggtggggcaatggcacca 152609
>emb|AL117192.5|CNS01DRE Human chromosome 14 DNA sequence BAC R-862G15 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 210869 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 240 aggtggggcaatggcaccaa 259 |||||||||||||||||||| Sbjct: 174610 aggtggggcaatggcaccaa 174629
>gb|AC154200.1| Mus musculus BAC clone RP24-81G10 from 17, complete sequence Length = 216721 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 103 aaaggtaaaagcaacaaaca 122 |||||||||||||||||||| Sbjct: 122665 aaaggtaaaagcaacaaaca 122646
>gb|AC102056.17| Mus musculus chromosome 5, clone RP23-190H2, complete sequence Length = 184495 Score = 40.1 bits (20), Expect = 3.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 101 gaaaaggtaaaagcaacaaa 120 |||||||||||||||||||| Sbjct: 37005 gaaaaggtaaaagcaacaaa 36986 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,222,468 Number of Sequences: 3902068 Number of extensions: 2222468 Number of successful extensions: 40432 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 40411 Number of HSP's gapped (non-prelim): 21 length of query: 273 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 251 effective length of database: 17,147,199,772 effective search space: 4303947142772 effective search space used: 4303947142772 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)