ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl17d10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC073483.1| Xenopus laevis cDNA clone IMAGE:5570009, partial cds 42 0.95
2gb|AC152977.1| Mus musculus 10 BAC RP23-251I19 (Roswell Park Can... 42 0.95
3gb|AC114748.4| Homo sapiens BAC clone RP11-164A18 from 2, comple... 42 0.95
4gb|AY112097.1| Zea mays CL313_-3 mRNA sequence 42 0.95
5gb|AC119980.7| Mus musculus chromosome 8, clone RP24-495J19, com... 40 3.8
6gb|AC132104.3| Mus musculus BAC clone RP24-364N7 from chromosome... 40 3.8
7gb|AC140210.2| Mus musculus BAC clone RP24-472L9 from chromosome... 40 3.8
8ref|XM_536952.2| PREDICTED: Canis familiaris similar to CG8202-P... 40 3.8
9ref|XM_646818.1| Entamoeba histolytica HM-1:IMSS AAA family ATPa... 40 3.8
10emb|AL096860.1|ATT21L8 Arabidopsis thaliana DNA chromosome 3, BA... 40 3.8
11gb|AC103706.2| Homo sapiens chromosome 8, clone RP11-629O1, comp... 40 3.8
12gb|AC090980.5| Homo sapiens chromosome 8, clone RP11-433O22, com... 40 3.8
13gb|DQ003082.1| Homo sapiens matrix metalloproteinase 16 (membran... 40 3.8
14gb|AF212832.5| Homo sapiens chromosome 8 clone CTC-806C5 map 8q2... 40 3.8
15gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome 40 3.8

>gb|BC073483.1| Xenopus laevis cDNA clone IMAGE:5570009, partial cds
          Length = 5458

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 68   aatcttctgcaccttactccc 88
            |||||||||||||||||||||
Sbjct: 5287 aatcttctgcaccttactccc 5307



to top

>gb|AC152977.1| Mus musculus 10 BAC RP23-251I19 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 192515

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 183   aaatcacaatgctagaaatgg 203
             |||||||||||||||||||||
Sbjct: 21906 aaatcacaatgctagaaatgg 21886



to top

>gb|AC114748.4| Homo sapiens BAC clone RP11-164A18 from 2, complete sequence
          Length = 127561

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 19     ttaagaaagatgacacacagc 39
              |||||||||||||||||||||
Sbjct: 104316 ttaagaaagatgacacacagc 104336



to top

>gb|AY112097.1| Zea mays CL313_-3 mRNA sequence
          Length = 603

 Score = 42.1 bits (21), Expect = 0.95
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 160 agcagagcaccaatcctaatc 180
           |||||||||||||||||||||
Sbjct: 408 agcagagcaccaatcctaatc 388



to top

>gb|AC119980.7| Mus musculus chromosome 8, clone RP24-495J19, complete sequence
          Length = 145150

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 182   gaaatcacaatgctagaaat 201
             ||||||||||||||||||||
Sbjct: 38616 gaaatcacaatgctagaaat 38597



to top

>gb|AC132104.3| Mus musculus BAC clone RP24-364N7 from chromosome 9, complete sequence
          Length = 161545

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 84     ctcccccctacactccattc 103
              ||||||||||||||||||||
Sbjct: 111178 ctcccccctacactccattc 111159



to top

>gb|AC140210.2| Mus musculus BAC clone RP24-472L9 from chromosome 13, complete sequence
          Length = 147418

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 4     caacatcttctcttcttaagaaag 27
             |||||||||||||||| |||||||
Sbjct: 94870 caacatcttctcttctaaagaaag 94847



to top

>ref|XM_536952.2| PREDICTED: Canis familiaris similar to CG8202-PA (LOC479825), mRNA
          Length = 3704

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 140  acagattcatggggatacag 159
            ||||||||||||||||||||
Sbjct: 1683 acagattcatggggatacag 1702



to top

>ref|XM_646818.1| Entamoeba histolytica HM-1:IMSS AAA family ATPase (141.t00003)
            partial mRNA
          Length = 2811

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 3    tcaacatcttctcttcttaa 22
            ||||||||||||||||||||
Sbjct: 2501 tcaacatcttctcttcttaa 2482



to top

>emb|AL096860.1|ATT21L8 Arabidopsis thaliana DNA chromosome 3, BAC clone T21L8
          Length = 87224

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 171   aatcctaatctgaaatcacaatgc 194
             ||||||||||| ||||||||||||
Sbjct: 29377 aatcctaatctaaaatcacaatgc 29354



to top

>gb|AC103706.2| Homo sapiens chromosome 8, clone RP11-629O1, complete sequence
          Length = 189207

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 247   gtagtactttacagttgaac 266
             ||||||||||||||||||||
Sbjct: 32416 gtagtactttacagttgaac 32397



to top

>gb|AC090980.5| Homo sapiens chromosome 8, clone RP11-433O22, complete sequence
          Length = 182881

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    cttcttaagaaagatgacac 34
             ||||||||||||||||||||
Sbjct: 51036 cttcttaagaaagatgacac 51055



to top

>gb|DQ003082.1| Homo sapiens matrix metalloproteinase 16 (membrane-inserted) (MMP16)
              gene, complete cds
          Length = 290137

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 15     cttcttaagaaagatgacac 34
              ||||||||||||||||||||
Sbjct: 141197 cttcttaagaaagatgacac 141178



to top

>gb|AF212832.5| Homo sapiens chromosome 8 clone CTC-806C5 map 8q24.3, complete sequence
          Length = 122029

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 247    gtagtactttacagttgaac 266
              ||||||||||||||||||||
Sbjct: 102536 gtagtactttacagttgaac 102555



to top

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 63     aaaataatcttctgcacctt 82
              ||||||||||||||||||||
Sbjct: 838347 aaaataatcttctgcacctt 838366


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,716,227
Number of Sequences: 3902068
Number of extensions: 2716227
Number of successful extensions: 76134
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76096
Number of HSP's gapped (non-prelim): 38
length of query: 288
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 266
effective length of database: 17,147,199,772
effective search space: 4561155139352
effective search space used: 4561155139352
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top