ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl17b10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AE017308.1| Mycoplasma mobile 163K complete genome 44 0.065
2dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticu... 42 0.26
3gb|AC018618.5|AC018618 Homo sapiens chromosome 15, clone RP11-16... 42 0.26
4emb|CT737352.3| Human DNA sequence from clone XX-HCC1954_35H21, ... 42 0.26
5gb|AC091981.4| Homo sapiens chromosome 5 clone RP11-549L3, compl... 42 0.26
6gb|AC155226.4| Rhinolophus ferrumequinum clone VMRC7-267P18, com... 40 1.0
7emb|BX296532.7| Zebrafish DNA sequence from clone CH211-281C19 i... 40 1.0
8gb|AC004955.3| Homo sapiens PAC clone RP5-1087M19 from 7, comple... 40 1.0
9emb|BX784022.6| Zebrafish DNA sequence from clone CH211-152C8 in... 40 1.0
10gb|DP000028.1| Rhinolophus ferrumequinum target 1 genomic scaffold 40 1.0
11gb|AC147213.3| Pan troglodytes BAC clone RP43-127I22 from chromo... 40 1.0
12gb|AC124156.3| Equus caballus clone CH241-280K8, complete sequence 40 1.0
13emb|CR847514.13| Zebrafish DNA sequence from clone DKEYP-11D6 in... 40 1.0
14gb|DP000020.1| Equus caballus target 1 genomic scaffold 40 1.0
15emb|AL607074.13| Mouse DNA sequence from clone RP23-174M9 on chr... 40 1.0
16ref|NM_112217.2| Arabidopsis thaliana unknown protein AT3G13680 ... 38 4.0
17ref|NM_112547.3| Arabidopsis thaliana unknown protein AT3G16740 ... 38 4.0
18ref|NM_112961.1| Arabidopsis thaliana unknown protein AT3G20700 ... 38 4.0
19gb|AE001412.2| Plasmodium falciparum 3D7 chromosome 2 section 49... 38 4.0
20gb|AC125273.9| Mus musculus chromosome 1, clone RP24-156N4, comp... 38 4.0
21ref|NM_015341.3| Homo sapiens barren homolog 1 (Drosophila) (BRR... 38 4.0
22gb|AC123833.3| Mus musculus BAC clone RP24-127A22 from chromosom... 38 4.0
23gb|AC146254.2| Pan troglodytes BAC clone CH251-128L22 from Y, co... 38 4.0
24gb|AE004208.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 38 4.0
25emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on ... 38 4.0
26emb|AL662888.5| Human DNA sequence from clone RP11-229H19 on chr... 38 4.0
27emb|AL049596.15|HSJ300A12 Human DNA sequence from clone RP1-300A... 38 4.0
28gb|AC157921.5| Mus musculus chromosome 1, clone RP23-129L19, com... 38 4.0
29gb|AC162301.3| Mus musculus chromosome 15, clone RP24-282H6, com... 38 4.0
30dbj|BS000629.2| Pan troglodytes chromosome Y clone: PTB-194O02, ... 38 4.0
31dbj|BS000552.1| Pan troglodytes chromosome Y clone:PTB-302F24, c... 38 4.0
32gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 38 4.0
33dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 38 4.0
34gb|AC021188.6| Homo sapiens BAC clone RP11-759A7 from 2, complet... 38 4.0
35gb|AC040164.5|AC040164 Homo sapiens chromosome 16 clone RP11-358... 38 4.0
36emb|BX822303.1|CNS0A642 Arabidopsis thaliana Full-length cDNA Co... 38 4.0
37gb|AC018848.6|AC018848 Arabidopsis thaliana chromosome 1 BAC F5I... 38 4.0
38gb|AC007907.3| Homo sapiens chromosome 16 clone RP11-324D17, com... 38 4.0
39gb|BT004826.1| Arabidopsis thaliana At3g16740 gene, complete cds 38 4.0
40gb|AC002531.1|AC002531 Homo sapiens chromosome Y, clone 486_O_8,... 38 4.0
41dbj|AP002034.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 38 4.0
42dbj|AP001307.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 38 4.0
43dbj|AB022217.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 38 4.0
44gb|AC004474.1|AC004474 Homo sapiens chromosome Y, clone 475I1, c... 38 4.0
45emb|AL805953.5| Mouse DNA sequence from clone RP23-189N21 on chr... 38 4.0 
>gb|AE017308.1| Mycoplasma mobile 163K complete genome
          Length = 777079

 Score = 44.1 bits (22), Expect = 0.065
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 7      tgataatgggacaaaaaataatttag 32
              |||||||||||| |||||||||||||
Sbjct: 118176 tgataatgggactaaaaataatttag 118151
to top
>dbj|AP008934.1| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 DNA,
              complete genome
          Length = 2516575

 Score = 42.1 bits (21), Expect = 0.26
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 17     acaaaaaataatttagaggga 37
              |||||||||||||||||||||
Sbjct: 533224 acaaaaaataatttagaggga 533244
to top
>gb|AC018618.5|AC018618 Homo sapiens chromosome 15, clone RP11-162I7, complete sequence
          Length = 156542

 Score = 42.1 bits (21), Expect = 0.26
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 7     tgataatgggacaaaaaataa 27
             |||||||||||||||||||||
Sbjct: 65750 tgataatgggacaaaaaataa 65770
to top
>emb|CT737352.3| Human DNA sequence from clone XX-HCC1954_35H21, complete sequence
          Length = 158492

 Score = 42.1 bits (21), Expect = 0.26
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 9   ataatgggacaaaaaataatttaga 33
           ||||||||||||||||||| |||||
Sbjct: 674 ataatgggacaaaaaataaattaga 650
to top
>gb|AC091981.4| Homo sapiens chromosome 5 clone RP11-549L3, complete sequence
          Length = 187685

 Score = 42.1 bits (21), Expect = 0.26
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 9    ataatgggacaaaaaataatttaga 33
            ||||||||||||||||||| |||||
Sbjct: 9768 ataatgggacaaaaaataaattaga 9744
to top
>gb|AC155226.4| Rhinolophus ferrumequinum clone VMRC7-267P18, complete sequence
          Length = 44085

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    aaaataatttagagggaaca 40
             ||||||||||||||||||||
Sbjct: 18455 aaaataatttagagggaaca 18474
to top
>emb|BX296532.7| Zebrafish DNA sequence from clone CH211-281C19 in linkage group 24,
             complete sequence
          Length = 155029

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    ctggactgataatccctgca 83
             ||||||||||||||||||||
Sbjct: 95073 ctggactgataatccctgca 95092
to top
>gb|AC004955.3| Homo sapiens PAC clone RP5-1087M19 from 7, complete sequence
          Length = 120557

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    atttagagggaacattttac 46
             ||||||||||||||||||||
Sbjct: 45817 atttagagggaacattttac 45836
to top
>emb|BX784022.6| Zebrafish DNA sequence from clone CH211-152C8 in linkage group 18,
             complete sequence
          Length = 153244

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    ctggactgataatccctgca 83
             ||||||||||||||||||||
Sbjct: 95028 ctggactgataatccctgca 95047
to top
>gb|DP000028.1| Rhinolophus ferrumequinum target 1 genomic scaffold
          Length = 1756392

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 21     aaaataatttagagggaaca 40
              ||||||||||||||||||||
Sbjct: 597808 aaaataatttagagggaaca 597827
to top
>gb|AC147213.3| Pan troglodytes BAC clone RP43-127I22 from chromosome 7, complete
              sequence
          Length = 205208

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 27     atttagagggaacattttac 46
              ||||||||||||||||||||
Sbjct: 136324 atttagagggaacattttac 136305
to top
>gb|AC124156.3| Equus caballus clone CH241-280K8, complete sequence
          Length = 184661

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    aaaataatttagagggaaca 40
             ||||||||||||||||||||
Sbjct: 65714 aaaataatttagagggaaca 65733
to top
>emb|CR847514.13| Zebrafish DNA sequence from clone DKEYP-11D6 in linkage group 3, complete
              sequence
          Length = 165569

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 32     gagggaacattttacaaggg 51
              ||||||||||||||||||||
Sbjct: 164182 gagggaacattttacaaggg 164163
to top
>gb|DP000020.1| Equus caballus target 1 genomic scaffold
          Length = 1907055

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 21     aaaataatttagagggaaca 40
              ||||||||||||||||||||
Sbjct: 727997 aaaataatttagagggaaca 728016
to top
>emb|AL607074.13| Mouse DNA sequence from clone RP23-174M9 on chromosome 4, complete
             sequence
          Length = 204428

 Score = 40.1 bits (20), Expect = 1.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    aaaataatttagagggaaca 40
             ||||||||||||||||||||
Sbjct: 37770 aaaataatttagagggaaca 37789
to top
>ref|NM_112217.2| Arabidopsis thaliana unknown protein AT3G13680 mRNA, complete cds
          Length = 1433

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 40  attttacaagggagagatt 58
           |||||||||||||||||||
Sbjct: 689 attttacaagggagagatt 707
to top
>ref|NM_112547.3| Arabidopsis thaliana unknown protein AT3G16740 mRNA, complete cds
          Length = 1494

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 40  attttacaagggagagatt 58
           |||||||||||||||||||
Sbjct: 880 attttacaagggagagatt 898
to top
>ref|NM_112961.1| Arabidopsis thaliana unknown protein AT3G20700 mRNA, complete cds
          Length = 981

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 40  attttacaagggagagatt 58
           |||||||||||||||||||
Sbjct: 566 attttacaagggagagatt 584
to top
>gb|AE001412.2| Plasmodium falciparum 3D7 chromosome 2 section 49 of 73 of the
            complete sequence
          Length = 12028

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 9    ataatgggacaaaaaataattta 31
            ||||||||||| |||||||||||
Sbjct: 8712 ataatgggacacaaaataattta 8690
to top
>gb|AC125273.9| Mus musculus chromosome 1, clone RP24-156N4, complete sequence
          Length = 187198

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 11    aatgggacaaaaaataatt 29
             |||||||||||||||||||
Sbjct: 81449 aatgggacaaaaaataatt 81431
to top
>ref|NM_015341.3| Homo sapiens barren homolog 1 (Drosophila) (BRRN1), mRNA
          Length = 4495

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 51   gagagattgctgactggac 69
            |||||||||||||||||||
Sbjct: 2951 gagagattgctgactggac 2969
to top
>gb|AC123833.3| Mus musculus BAC clone RP24-127A22 from chromosome 13, complete
             sequence
          Length = 146493

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 30    tagagggaacattttacaa 48
             |||||||||||||||||||
Sbjct: 43782 tagagggaacattttacaa 43764
to top
>gb|AC146254.2| Pan troglodytes BAC clone CH251-128L22 from Y, complete sequence
          Length = 177240

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 47    aagggagagattgctgactggac 69
             ||||||||||||||||| |||||
Sbjct: 78217 aagggagagattgctgaatggac 78239
to top
>gb|AE004208.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 116
            of 251 of the complete chromosome
          Length = 10254

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 57   ttgctgactggactgataatccc 79
            |||||||||||| ||||||||||
Sbjct: 8799 ttgctgactggattgataatccc 8777
to top
>emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on chromosome 22q13.2-13.33,
             complete sequence
          Length = 92472

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 37    aacattttacaagggagagattg 59
             |||||||||||| ||||||||||
Sbjct: 67834 aacattttacaacggagagattg 67812
to top
>emb|AL662888.5| Human DNA sequence from clone RP11-229H19 on chromosome 1, complete
             sequence
          Length = 48023

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 11    aatgggacaaaaaataatt 29
             |||||||||||||||||||
Sbjct: 14779 aatgggacaaaaaataatt 14761
to top
>emb|AL049596.15|HSJ300A12 Human DNA sequence from clone RP1-300A12 on chromosome 1q24.1-24.3
             Contains STSs and GSSs, complete sequence
          Length = 56854

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    atgggacaaaaaataattt 30
             |||||||||||||||||||
Sbjct: 31764 atgggacaaaaaataattt 31746
to top
>gb|AC157921.5| Mus musculus chromosome 1, clone RP23-129L19, complete sequence
          Length = 220521

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 11    aatgggacaaaaaataatt 29
             |||||||||||||||||||
Sbjct: 86346 aatgggacaaaaaataatt 86364
to top
>gb|AC162301.3| Mus musculus chromosome 15, clone RP24-282H6, complete sequence
          Length = 171176

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 31    agagggaacattttacaagggag 53
             |||||||||||||| ||||||||
Sbjct: 63094 agagggaacattttccaagggag 63072
to top
>dbj|BS000629.2| Pan troglodytes chromosome Y clone: PTB-194O02, complete sequence
          Length = 184689

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 47     aagggagagattgctgactggac 69
              ||||||||||||||||| |||||
Sbjct: 143859 aagggagagattgctgaatggac 143881
to top
>dbj|BS000552.1| Pan troglodytes chromosome Y clone:PTB-302F24, complete sequences
          Length = 157728

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 47    aagggagagattgctgactggac 69
             ||||||||||||||||| |||||
Sbjct: 66235 aagggagagattgctgaatggac 66213
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 47       aagggagagattgctgactggac 69
                ||||||||||||||||| |||||
Sbjct: 17997842 aagggagagattgctgaatggac 17997820
to top
>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026
          Length = 2324132

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 53      gagattgctgactggactg 71
               |||||||||||||||||||
Sbjct: 1186199 gagattgctgactggactg 1186217
to top
>gb|AC021188.6| Homo sapiens BAC clone RP11-759A7 from 2, complete sequence
          Length = 236486

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 51     gagagattgctgactggac 69
              |||||||||||||||||||
Sbjct: 108412 gagagattgctgactggac 108430
to top
>gb|AC040164.5|AC040164 Homo sapiens chromosome 16 clone RP11-358B6, complete sequence
          Length = 164968

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 19    aaaaaataatttagaggga 37
             |||||||||||||||||||
Sbjct: 75189 aaaaaataatttagaggga 75207
to top
>emb|BX822303.1|CNS0A642 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB27ZF04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1366

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 40  attttacaagggagagatt 58
           |||||||||||||||||||
Sbjct: 851 attttacaagggagagatt 869
to top
>gb|AC018848.6|AC018848 Arabidopsis thaliana chromosome 1 BAC F5I6 genomic sequence, complete
            sequence
          Length = 132990

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 71   gataatccctgcaagttccatcc 93
            |||||| ||||||||||||||||
Sbjct: 7874 gataatacctgcaagttccatcc 7852
to top
>gb|AC007907.3| Homo sapiens chromosome 16 clone RP11-324D17, complete sequence
          Length = 170669

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 19     aaaaaataatttagaggga 37
              |||||||||||||||||||
Sbjct: 136223 aaaaaataatttagaggga 136205
to top
>gb|BT004826.1| Arabidopsis thaliana At3g16740 gene, complete cds
          Length = 1176

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 40  attttacaagggagagatt 58
           |||||||||||||||||||
Sbjct: 737 attttacaagggagagatt 755
to top
>gb|AC002531.1|AC002531 Homo sapiens chromosome Y, clone 486_O_8, complete sequence
          Length = 197900

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 47     aagggagagattgctgactggac 69
              ||||||||||||||||| |||||
Sbjct: 189859 aagggagagattgctgaatggac 189837
to top
>dbj|AP002034.1| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone: F3H11
          Length = 33442

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 40    attttacaagggagagatt 58
             |||||||||||||||||||
Sbjct: 27945 attttacaagggagagatt 27927
to top
>dbj|AP001307.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMM17
          Length = 80733

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 40    attttacaagggagagatt 58
             |||||||||||||||||||
Sbjct: 22886 attttacaagggagagatt 22868
to top
>dbj|AB022217.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6
          Length = 79459

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 40    attttacaagggagagatt 58
             |||||||||||||||||||
Sbjct: 66262 attttacaagggagagatt 66280
to top
>gb|AC004474.1|AC004474 Homo sapiens chromosome Y, clone 475I1, complete sequence
          Length = 148280

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 47    aagggagagattgctgactggac 69
             ||||||||||||||||| |||||
Sbjct: 36153 aagggagagattgctgaatggac 36131
to top
>emb|AL805953.5| Mouse DNA sequence from clone RP23-189N21 on chromosome 2, complete
              sequence
          Length = 173345

 Score = 38.2 bits (19), Expect = 4.0
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 26     aatttagagggaacatttt 44
              |||||||||||||||||||
Sbjct: 165697 aatttagagggaacatttt 165715


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,315,448
Number of Sequences: 3902068
Number of extensions: 1315448
Number of successful extensions: 98257
Number of sequences better than 10.0: 45
Number of HSP's better than 10.0 without gapping: 45
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 98051
Number of HSP's gapped (non-prelim): 206
length of query: 93
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 72
effective length of database: 17,151,101,840
effective search space: 1234879332480
effective search space used: 1234879332480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top