Clone Name | rbastl17b07 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_467437.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3793 Score = 137 bits (69), Expect = 3e-29 Identities = 114/129 (88%) Strand = Plus / Minus Query: 277 tgcaacgcttttattgttctcctcttccatgtgtcggtctccggttcaaaagtgagctcc 336 ||||||||||||||| ||| ||||||||||||| ||||| |||||||| |||||||| Sbjct: 3468 tgcaacgcttttattattcccctcttccatgtggaagtctctggttcaaacctgagctcc 3409 Query: 337 caggtcggccaatagtgaaggtcctgtttcagagtgagcacccgtggtttcccgttcaaa 396 ||||||||||| ||||||||||||||||||| ||| ||||| || ||||| || |||||| Sbjct: 3408 caggtcggccagtagtgaaggtcctgtttcaaagtaagcacacgaggtttgccattcaaa 3349 Query: 397 tggacggtc 405 ||||||||| Sbjct: 3348 tggacggtc 3340 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 89 aattatccacaggcaatgaa 108 |||||||||||||||||||| Sbjct: 3709 aattatccacaggcaatgaa 3690
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 137 bits (69), Expect = 3e-29 Identities = 114/129 (88%) Strand = Plus / Plus Query: 277 tgcaacgcttttattgttctcctcttccatgtgtcggtctccggttcaaaagtgagctcc 336 ||||||||||||||| ||| ||||||||||||| ||||| |||||||| |||||||| Sbjct: 29502251 tgcaacgcttttattattcccctcttccatgtggaagtctctggttcaaacctgagctcc 29502310 Query: 337 caggtcggccaatagtgaaggtcctgtttcagagtgagcacccgtggtttcccgttcaaa 396 ||||||||||| ||||||||||||||||||| ||| ||||| || ||||| || |||||| Sbjct: 29502311 caggtcggccagtagtgaaggtcctgtttcaaagtaagcacacgaggtttgccattcaaa 29502370 Query: 397 tggacggtc 405 ||||||||| Sbjct: 29502371 tggacggtc 29502379 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 89 aattatccacaggcaatgaa 108 |||||||||||||||||||| Sbjct: 29502010 aattatccacaggcaatgaa 29502029
>dbj|AP003983.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1038_A06 Length = 147836 Score = 137 bits (69), Expect = 3e-29 Identities = 114/129 (88%) Strand = Plus / Plus Query: 277 tgcaacgcttttattgttctcctcttccatgtgtcggtctccggttcaaaagtgagctcc 336 ||||||||||||||| ||| ||||||||||||| ||||| |||||||| |||||||| Sbjct: 97281 tgcaacgcttttattattcccctcttccatgtggaagtctctggttcaaacctgagctcc 97340 Query: 337 caggtcggccaatagtgaaggtcctgtttcagagtgagcacccgtggtttcccgttcaaa 396 ||||||||||| ||||||||||||||||||| ||| ||||| || ||||| || |||||| Sbjct: 97341 caggtcggccagtagtgaaggtcctgtttcaaagtaagcacacgaggtttgccattcaaa 97400 Query: 397 tggacggtc 405 ||||||||| Sbjct: 97401 tggacggtc 97409 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 89 aattatccacaggcaatgaa 108 |||||||||||||||||||| Sbjct: 97040 aattatccacaggcaatgaa 97059
>dbj|AK065045.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001I02, full insert sequence Length = 3793 Score = 137 bits (69), Expect = 3e-29 Identities = 114/129 (88%) Strand = Plus / Minus Query: 277 tgcaacgcttttattgttctcctcttccatgtgtcggtctccggttcaaaagtgagctcc 336 ||||||||||||||| ||| ||||||||||||| ||||| |||||||| |||||||| Sbjct: 3468 tgcaacgcttttattattcccctcttccatgtggaagtctctggttcaaacctgagctcc 3409 Query: 337 caggtcggccaatagtgaaggtcctgtttcagagtgagcacccgtggtttcccgttcaaa 396 ||||||||||| ||||||||||||||||||| ||| ||||| || ||||| || |||||| Sbjct: 3408 caggtcggccagtagtgaaggtcctgtttcaaagtaagcacacgaggtttgccattcaaa 3349 Query: 397 tggacggtc 405 ||||||||| Sbjct: 3348 tggacggtc 3340
>emb|AL355984.11| Human DNA sequence from clone RP11-501K3 on chromosome 13 Contains the GJB6 gene for gap junction protein, beta 6 (connexin 30) and 2 CpG islands, complete sequence Length = 160536 Score = 46.1 bits (23), Expect = 0.089 Identities = 26/27 (96%) Strand = Plus / Minus Query: 46 aaaatatatgaaataggtacagaaaag 72 ||||||||||||||| ||||||||||| Sbjct: 74740 aaaatatatgaaatatgtacagaaaag 74714
>emb|CR382398.1| Plasmodium falciparum chromosome 6, complete sequence; segment 1/5 Length = 349418 Score = 46.1 bits (23), Expect = 0.089 Identities = 23/23 (100%) Strand = Plus / Plus Query: 40 ataataaaaatatatgaaatagg 62 ||||||||||||||||||||||| Sbjct: 197399 ataataaaaatatatgaaatagg 197421
>gb|AC116798.11| Mus musculus chromosome 1, clone RP24-329K22, complete sequence Length = 173479 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 191 ttcctcgcctctccatgcttg 211 ||||||||||||||||||||| Sbjct: 93705 ttcctcgcctctccatgcttg 93685
>gb|AY318871.1| Canarypox virus strain ATCC VR-111, complete genome Length = 359853 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 41 taataaaaatatatgaaataggtacagaa 69 |||||||| || ||||||||||||||||| Sbjct: 28886 taataaaagtagatgaaataggtacagaa 28858
>emb|CR847496.7| Zebrafish DNA sequence from clone CH211-203D1 in linkage group 14, complete sequence Length = 157741 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 40 ataataaaaatatatgaaata 60 ||||||||||||||||||||| Sbjct: 81427 ataataaaaatatatgaaata 81447
>gb|AC114553.6| Mus musculus chromosome 5, clone RP23-408M16, complete sequence Length = 198281 Score = 42.1 bits (21), Expect = 1.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 29 gcttctacaggataataaaaatatatgaaatag 61 |||||||||||||||||||| | ||||||||| Sbjct: 181059 gcttctacaggataataaaataaaatgaaatag 181027
>emb|AL713998.7| Human DNA sequence from clone RP11-301G19 on chromosome 6, complete sequence Length = 184887 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 ctacaggataataaaaatata 53 ||||||||||||||||||||| Sbjct: 88035 ctacaggataataaaaatata 88015
>gb|AC158753.8| Mus musculus chromosome 5, clone RP23-301E24, complete sequence Length = 190368 Score = 42.1 bits (21), Expect = 1.4 Identities = 30/33 (90%) Strand = Plus / Minus Query: 29 gcttctacaggataataaaaatatatgaaatag 61 |||||||||||||||||||| | ||||||||| Sbjct: 18421 gcttctacaggataataaaataaaatgaaatag 18389
>gb|AC023904.10| Homo sapiens chromosome 10 clone RP11-369L1, complete sequence Length = 190712 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 40 ataataaaaatatatgaaata 60 ||||||||||||||||||||| Sbjct: 107659 ataataaaaatatatgaaata 107679
>gb|AC131005.3| Homo sapiens 3 BAC RP11-88K11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 191231 Score = 42.1 bits (21), Expect = 1.4 Identities = 27/29 (93%) Strand = Plus / Minus Query: 27 ttgcttctacaggataataaaaatatatg 55 ||||||||||| || |||||||||||||| Sbjct: 109828 ttgcttctacatgagaataaaaatatatg 109800
>emb|AL954143.9| Zebrafish DNA sequence from clone CH211-206A7 in linkage group 19, complete sequence Length = 168515 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 40 ataataaaaatatatgaaata 60 ||||||||||||||||||||| Sbjct: 66230 ataataaaaatatatgaaata 66250
>emb|CR759813.6| Zebrafish DNA sequence from clone DKEY-150H10 in linkage group 18, complete sequence Length = 152902 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 40 ataataaaaatatatgaaata 60 ||||||||||||||||||||| Sbjct: 47337 ataataaaaatatatgaaata 47317
>gb|AC142502.3| Mus musculus BAC clone RP24-530L11 from 3, complete sequence Length = 160259 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 ctccatgcttggccttcctaa 221 ||||||||||||||||||||| Sbjct: 124107 ctccatgcttggccttcctaa 124087
>gb|AC137127.11| Mus musculus chromosome 9, clone RP24-264F17, complete sequence Length = 181842 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 350 agtgaaggtcctgtttcagagtga 373 |||||||||||||| ||||||||| Sbjct: 63810 agtgaaggtcctgtgtcagagtga 63833
>ref|NM_012674.1| Rattus norvegicus serine protease inhibitor, Kazal type 1 (Spink1), mRNA Length = 2338 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 ataataaaaatatatgaaat 59 |||||||||||||||||||| Sbjct: 2301 ataataaaaatatatgaaat 2320
>gb|AC150162.1| Solanum demissum chromosome 5 clone PGEC160O2 map MAP_LOC, complete sequence Length = 125813 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 taataaaaatatatgaaata 60 |||||||||||||||||||| Sbjct: 65736 taataaaaatatatgaaata 65717
>gb|AC009394.5| Drosophila melanogaster clone BACR03J17, complete sequence Length = 199043 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 ataaaaatatatgaaatagg 62 |||||||||||||||||||| Sbjct: 26393 ataaaaatatatgaaatagg 26412
>gb|AC009462.7| Drosophila melanogaster clone BACR27G04, complete sequence Length = 151609 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 ataaaaatatatgaaatagg 62 |||||||||||||||||||| Sbjct: 106463 ataaaaatatatgaaatagg 106482
>gb|AC138330.4| Mus musculus BAC clone RP23-19L20 from chromosome 13, complete sequence Length = 190901 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 39 gataataaaaatatatgaaa 58 |||||||||||||||||||| Sbjct: 173690 gataataaaaatatatgaaa 173671
>gb|AC132270.3| Mus musculus BAC clone RP24-338C23 from chromosome 5, complete sequence Length = 145471 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 ataataaaaatatatgaaat 59 |||||||||||||||||||| Sbjct: 15740 ataataaaaatatatgaaat 15721
>ref|XM_001003764.1| PREDICTED: Mus musculus gamma-aminobutyric acid (GABA) receptor, rho 3, transcript variant 2 (Gabrr3), mRNA Length = 1456 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 171 gcatcgacagcatttcagag 190 |||||||||||||||||||| Sbjct: 269 gcatcgacagcatttcagag 288
>ref|XM_917722.2| PREDICTED: Mus musculus gamma-aminobutyric acid (GABA) receptor, rho 3, transcript variant 3 (Gabrr3), mRNA Length = 1456 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 171 gcatcgacagcatttcagag 190 |||||||||||||||||||| Sbjct: 269 gcatcgacagcatttcagag 288
>ref|XM_285181.6| PREDICTED: Mus musculus gamma-aminobutyric acid (GABA) receptor, rho 3, transcript variant 1 (Gabrr3), mRNA Length = 1456 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 171 gcatcgacagcatttcagag 190 |||||||||||||||||||| Sbjct: 269 gcatcgacagcatttcagag 288
>gb|AC123840.4| Mus musculus BAC clone RP23-399K5 from chromosome 13, complete sequence Length = 191185 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 39 gataataaaaatatatgaaa 58 |||||||||||||||||||| Sbjct: 30797 gataataaaaatatatgaaa 30778
>gb|AC122016.4| Mus musculus BAC clone RP24-359J23 from chromosome 16, complete sequence Length = 163943 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 acaggataataaaaatatat 54 |||||||||||||||||||| Sbjct: 88449 acaggataataaaaatatat 88430
>gb|AC157800.9| Mus musculus chromosome 1, clone RP24-286C21, complete sequence Length = 164708 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 ataataaaaatatatgaaat 59 |||||||||||||||||||| Sbjct: 29776 ataataaaaatatatgaaat 29795
>emb|AL513166.7| Human DNA sequence from clone RP11-261J10 on chromosome 1, complete sequence Length = 170817 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 210 tggccttcctaaagaaggcc 229 |||||||||||||||||||| Sbjct: 13243 tggccttcctaaagaaggcc 13262
>gb|AC069504.7| Homo sapiens 3 BAC RP11-263A24 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 39624 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 ataaaaatatatgaaatagg 62 |||||||||||||||||||| Sbjct: 30433 ataaaaatatatgaaatagg 30452
>gb|AC090671.5| Homo sapiens 12 BAC RP11-755O11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 186298 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 45 aaaaatatatgaaataggta 64 |||||||||||||||||||| Sbjct: 16813 aaaaatatatgaaataggta 16832
>emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces hansenii Length = 2037969 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 taataaaaatatatgaaata 60 |||||||||||||||||||| Sbjct: 1475497 taataaaaatatatgaaata 1475478
>gb|AC091096.7| Homo sapiens chromosome 8, clone RP11-587H10, complete sequence Length = 207630 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 227 gcccactgaaaatatcacaa 246 |||||||||||||||||||| Sbjct: 185838 gcccactgaaaatatcacaa 185819
>gb|AC090506.7| Homo sapiens chromosome 18, clone RP11-675P14, complete sequence Length = 188609 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 29 gcttctacaggataataaaaatat 52 ||||||||||||||||| |||||| Sbjct: 82368 gcttctacaggataatacaaatat 82345
>emb|AL805942.5| Mouse DNA sequence from clone RP24-71G5 on chromosome 2, complete sequence Length = 81209 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 taataaaaatatatgaaata 60 |||||||||||||||||||| Sbjct: 79111 taataaaaatatatgaaata 79130
>gb|AY040765.1| Mus musculus histidine triad protein 3 gene, complete cds Length = 2916 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 43 ataaaaatatatgaaatagg 62 |||||||||||||||||||| Sbjct: 2901 ataaaaatatatgaaatagg 2882
>gb|AY998454.1| Solanum pectinatum voucher Peeke 8512 IND tRNA-Ser (trnS) gene, partial sequence; trnS-trnG intergenic spacer, complete sequence; and tRNA-Gly (trnG) gene, partial sequence; chloroplast Length = 688 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 aataaaaatatatgaaatag 61 |||||||||||||||||||| Sbjct: 431 aataaaaatatatgaaatag 450
>gb|AC009709.7|AC009709 Homo sapiens chromosome 18, clone RP11-319O9, complete sequence Length = 187615 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 25 tattgcttctacaggataataaaa 48 ||||||||| |||||||||||||| Sbjct: 66177 tattgcttccacaggataataaaa 66200
>gb|AC022193.5|AC022193 Homo sapiens, clone RP11-23B3, complete sequence Length = 184228 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 gcccactgaaaatatcacaa 246 |||||||||||||||||||| Sbjct: 106215 gcccactgaaaatatcacaa 106234
>gb|AC154854.2| Mus musculus BAC clone RP23-23O4 from chromosome 16, complete sequence Length = 209970 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 171 gcatcgacagcatttcagag 190 |||||||||||||||||||| Sbjct: 118975 gcatcgacagcatttcagag 118994
>gb|AC018878.8| Homo sapiens BAC clone RP11-297N12 from 2, complete sequence Length = 170801 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 taataaaaatatatgaaata 60 |||||||||||||||||||| Sbjct: 127695 taataaaaatatatgaaata 127714
>gb|AC007274.3|AC007274 Homo sapiens BAC clone RP11-105L10 from Y, complete sequence Length = 117309 Score = 40.1 bits (20), Expect = 5.5 Identities = 26/28 (92%) Strand = Plus / Minus Query: 117 gtcatctattgaattacactatatccta 144 ||||| ||||||||||||||||| |||| Sbjct: 55997 gtcatttattgaattacactataaccta 55970
>gb|AC006195.1|AC006195 Homo sapiens clone RP11-350H1 from 7p14-15, complete sequence Length = 150242 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 ataaaaatatatgaaatagg 62 |||||||||||||||||||| Sbjct: 140438 ataaaaatatatgaaatagg 140457
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome Length = 6413771 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 ttctacaggataataaaaat 50 |||||||||||||||||||| Sbjct: 281695 ttctacaggataataaaaat 281714
>gb|AC007911.8|AC007911 Homo sapiens chromosome 18, clone RP11-520K18, complete sequence Length = 160299 Score = 40.1 bits (20), Expect = 5.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 25 tattgcttctacaggataataaaa 48 ||||||||| |||||||||||||| Sbjct: 59912 tattgcttccacaggataataaaa 59935
>gb|AE003721.3| Drosophila melanogaster chromosome 3R, section 59 of 118 of the complete sequence Length = 224889 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 ataaaaatatatgaaatagg 62 |||||||||||||||||||| Sbjct: 46887 ataaaaatatatgaaatagg 46906
>emb|AL732626.8| Mouse DNA sequence from clone RP23-191F22 on chromosome 4, complete sequence Length = 151688 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 43 ataaaaatatatgaaatagg 62 |||||||||||||||||||| Sbjct: 91473 ataaaaatatatgaaatagg 91492
>gb|M35299.1|RATPSTIAA Rat pancreatic secretory trypsin inhibitor-like protein (PSTI) mRNA, complete cds Length = 2338 Score = 40.1 bits (20), Expect = 5.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 ataataaaaatatatgaaat 59 |||||||||||||||||||| Sbjct: 2301 ataataaaaatatatgaaat 2320 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,241,985 Number of Sequences: 3902068 Number of extensions: 4241985 Number of successful extensions: 94586 Number of sequences better than 10.0: 50 Number of HSP's better than 10.0 without gapping: 50 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 94438 Number of HSP's gapped (non-prelim): 148 length of query: 410 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 388 effective length of database: 17,147,199,772 effective search space: 6653113511536 effective search space used: 6653113511536 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)