ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl17a06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 101 2e-18
2dbj|AP005560.3| Oryza sativa (japonica cultivar-group) genomic D... 101 2e-18
3dbj|AK109602.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 2e-18
4gb|AC117834.6| Homo sapiens chromosome 8, clone CTD-3239E11, com... 44 0.31
5emb|AL078593.9|HSDJ210B1 Human DNA sequence from clone RP1-210B1... 42 1.2
6gb|AC025366.11| Homo sapiens chromosome 8, clone RP11-238I10, co... 42 1.2
7gb|AC093788.3| Homo sapiens BAC clone RP11-218F10 from 4, comple... 42 1.2
8gb|AC079402.5| Homo sapiens BAC clone RP11-597E15 from 2, comple... 42 1.2
9gb|AC104069.3| Homo sapiens BAC clone RP11-279B11 from 2, comple... 42 1.2
10gb|AC090819.7| Homo sapiens chromosome 8, clone CTD-2544L4, comp... 42 1.2
11dbj|AP001804.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 1.2
12dbj|AP002965.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 1.2
13gb|AC002556.1|AC002556 Human Chromosome 11q25 PAC clone pDJ9j14,... 42 1.2
14dbj|AP003693.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 42 1.2
15gb|AC163325.7| Mus musculus chromosome 1, clone RP23-76L21, comp... 40 4.9
16gb|AY591682.1| Mus musculus clone IgK8-27 immunoglobulin kappa-l... 40 4.9
17gb|AC159715.5| Mus musculus 6 BAC RP23-367A13 (Roswell Park Canc... 40 4.9
18gb|AC124538.4| Mus musculus BAC clone RP23-338P10 from chromosom... 40 4.9
19gb|AC121980.2| Mus musculus BAC clone RP24-290F15 from 1, comple... 40 4.9
20emb|AL513318.8| Human DNA sequence from clone RP11-276H19 on chr... 40 4.9
21emb|AL354982.12| Human DNA sequence from clone RP11-473H13 on ch... 40 4.9
22emb|AL133347.28| Human DNA sequence from clone RP1-274L14 on chr... 40 4.9
23gb|AC108924.5| Homo sapiens chromosome 8, clone RP11-1113C19, co... 40 4.9
24gb|AC155332.10| Mus musculus 6 BAC RP24-140J8 (Roswell Park Canc... 40 4.9
25emb|BX323543.11| Zebrafish DNA sequence from clone DKEYP-67E1 in... 40 4.9
26gb|AC116154.2| Homo sapiens chromosome 8, clone RP11-927P11, com... 40 4.9
27gb|AC103792.2| Homo sapiens chromosome 11, clone CTD-2384B9, com... 40 4.9
28gb|AC114284.2| Homo sapiens chromosome 5 clone CTD-2334D19, comp... 40 4.9
29gb|AC109998.2| Homo sapiens chromosome 5 clone CTD-2203A3, compl... 40 4.9
30gb|AC119156.9| Mus musculus chromosome 1, clone RP24-534J20, com... 40 4.9
31gb|AC091903.2| Homo sapiens chromosome 5 clone RP11-182I21, comp... 40 4.9
32gb|AC158672.6| Mus musculus 6 BAC RP23-64J23 (Roswell Park Cance... 40 4.9
33emb|BX284697.8| Zebrafish DNA sequence from clone DKEY-7M11 in l... 40 4.9
34gb|AC016725.5| Homo sapiens BAC clone RP11-341H1 from 2, complet... 40 4.9
35gb|AC084063.5| Homo sapiens chromosome 16 clone RP11-255J12, com... 40 4.9
36emb|AL132668.4|CNS01DT9 Human chromosome 14 DNA sequence BAC R-5... 40 4.9
37gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome 40 4.9
38gb|AC111089.27| Mus musculus chromosome 5, clone RP23-156F20, co... 40 4.9
39dbj|AP004287.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 4.9 
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score =  101 bits (51), Expect = 2e-18
 Identities = 114/135 (84%)
 Strand = Plus / Minus

                                                                           
Query: 232     actttcaccttcttgctggtggctttatcaactttctcgctttcaaccttcatctttttt 291
               |||||||||||||||||| | ||||| ||||| |||||  |||| ||||||||||| || 
Sbjct: 3070723 actttcaccttcttgctgttagctttgtcaaccttctcattttcgaccttcatcttcttg 3070664

                                                                           
Query: 292     atggaatccaaaagcgatgatgactgttctttgttggatgaaaattttgcaaatgggtta 351
               |||||||| ||||| ||||||| |||||||||| | |||||  |||| || || ||||||
Sbjct: 3070663 atggaatcaaaaagggatgatggctgttctttgcttgatgaggatttcgcgaaggggtta 3070604

                              
Query: 352     agtggccgttgaggc 366
               | |||||| ||||||
Sbjct: 3070603 actggccgctgaggc 3070589
to top
>dbj|AP005560.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1178_D01
          Length = 121768

 Score =  101 bits (51), Expect = 2e-18
 Identities = 114/135 (84%)
 Strand = Plus / Minus

                                                                         
Query: 232   actttcaccttcttgctggtggctttatcaactttctcgctttcaaccttcatctttttt 291
             |||||||||||||||||| | ||||| ||||| |||||  |||| ||||||||||| || 
Sbjct: 90689 actttcaccttcttgctgttagctttgtcaaccttctcattttcgaccttcatcttcttg 90630

                                                                         
Query: 292   atggaatccaaaagcgatgatgactgttctttgttggatgaaaattttgcaaatgggtta 351
             |||||||| ||||| ||||||| |||||||||| | |||||  |||| || || ||||||
Sbjct: 90629 atggaatcaaaaagggatgatggctgttctttgcttgatgaggatttcgcgaaggggtta 90570

                            
Query: 352   agtggccgttgaggc 366
             | |||||| ||||||
Sbjct: 90569 actggccgctgaggc 90555
to top
>dbj|AK109602.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-137-E09, full
            insert sequence
          Length = 2854

 Score =  101 bits (51), Expect = 2e-18
 Identities = 114/135 (84%)
 Strand = Plus / Minus

                                                                        
Query: 232  actttcaccttcttgctggtggctttatcaactttctcgctttcaaccttcatctttttt 291
            |||||||||||||||||| | ||||| ||||| |||||  |||| ||||||||||| || 
Sbjct: 2634 actttcaccttcttgctgttagctttgtcaaccttctcattttcgaccttcatcttcttg 2575

                                                                        
Query: 292  atggaatccaaaagcgatgatgactgttctttgttggatgaaaattttgcaaatgggtta 351
            |||||||| ||||| ||||||| |||||||||| | |||||  |||| || || ||||||
Sbjct: 2574 atggaatcaaaaagggatgatggctgttctttgcttgatgaggatttcgcgaaggggtta 2515

                           
Query: 352  agtggccgttgaggc 366
            | |||||| ||||||
Sbjct: 2514 actggccgctgaggc 2500
to top
>gb|AC117834.6| Homo sapiens chromosome 8, clone CTD-3239E11, complete sequence
          Length = 189536

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 320    ctttgttggatgaaaattttgcaaat 345
              |||||||||||||| |||||||||||
Sbjct: 159659 ctttgttggatgaatattttgcaaat 159684
to top
>emb|AL078593.9|HSDJ210B1 Human DNA sequence from clone RP1-210B1 on chromosome 6q23.3-25.1
             Contains part of the gene for a novel protein (contains
             KIAA0680), complete sequence
          Length = 132433

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 317   gttctttgttggatgaaaattttgcaaat 345
             |||| |||||||||||| |||||||||||
Sbjct: 43388 gttcattgttggatgaatattttgcaaat 43360
to top
>gb|AC025366.11| Homo sapiens chromosome 8, clone RP11-238I10, complete sequence
          Length = 157390

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 317   gttctttgttggatgaaaattttgcaaat 345
             ||||||||||||||| ||| |||||||||
Sbjct: 10951 gttctttgttggatgtaaagtttgcaaat 10923
to top
>gb|AC093788.3| Homo sapiens BAC clone RP11-218F10 from 4, complete sequence
          Length = 160853

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 112   caactacactaccagaattttaagtggaa 140
             ||||| ||||||||||| |||||||||||
Sbjct: 46634 caactccactaccagaactttaagtggaa 46606
to top
>gb|AC079402.5| Homo sapiens BAC clone RP11-597E15 from 2, complete sequence
          Length = 86973

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 135   gtggaaaggaaaggcacttca 155
             |||||||||||||||||||||
Sbjct: 49336 gtggaaaggaaaggcacttca 49356
to top
>gb|AC104069.3| Homo sapiens BAC clone RP11-279B11 from 2, complete sequence
          Length = 155106

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 320   ctttgttggatgaaaattttgcaaa 344
             |||||||||||||| ||||||||||
Sbjct: 42807 ctttgttggatgaatattttgcaaa 42831
to top
>gb|AC090819.7| Homo sapiens chromosome 8, clone CTD-2544L4, complete sequence
          Length = 208961

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 317    gttctttgttggatgaaaattttgcaaat 345
              ||||||||||||||| ||| |||||||||
Sbjct: 169068 gttctttgttggatgtaaagtttgcaaat 169040
to top
>dbj|AP001804.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-164A10, complete
             sequence
          Length = 166302

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 317   gttctttgttggatgaaaattttgcaaat 345
             ||||||||||||||||| | |||||||||
Sbjct: 46821 gttctttgttggatgaatagtttgcaaat 46793
to top
>dbj|AP002965.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-299I2, complete
              sequence
          Length = 150481

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 317    gttctttgttggatgaaaattttgcaaat 345
              ||||||||||||||||| | |||||||||
Sbjct: 134020 gttctttgttggatgaatagtttgcaaat 133992
to top
>gb|AC002556.1|AC002556 Human Chromosome 11q25 PAC clone pDJ9j14, complete sequence
          Length = 123189

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 317   gttctttgttggatgaaaattttgcaaat 345
             ||||||||||||||||| | |||||||||
Sbjct: 40053 gttctttgttggatgaatagtttgcaaat 40025
to top
>dbj|AP003693.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1762B7, complete
             sequence
          Length = 150581

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 317   gttctttgttggatgaaaattttgcaaat 345
             ||||||||||||||| ||| |||||||||
Sbjct: 74947 gttctttgttggatgtaaagtttgcaaat 74919
to top
>gb|AC163325.7| Mus musculus chromosome 1, clone RP23-76L21, complete sequence
          Length = 253153

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    agactacaaagtaaactcag 103
             ||||||||||||||||||||
Sbjct: 28940 agactacaaagtaaactcag 28921
to top
>gb|AY591682.1| Mus musculus clone IgK8-27 immunoglobulin kappa-like gene, partial
            sequence
          Length = 2901

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 210  aatgacaagaaaaaacaatt 229
            ||||||||||||||||||||
Sbjct: 2792 aatgacaagaaaaaacaatt 2773
to top
>gb|AC159715.5| Mus musculus 6 BAC RP23-367A13 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 209869

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 210    aatgacaagaaaaaacaatt 229
              ||||||||||||||||||||
Sbjct: 190288 aatgacaagaaaaaacaatt 190307
to top
>gb|AC124538.4| Mus musculus BAC clone RP23-338P10 from chromosome 1, complete sequence
          Length = 181512

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 233    ctttcaccttcttgctggtg 252
              ||||||||||||||||||||
Sbjct: 171897 ctttcaccttcttgctggtg 171878
to top
>gb|AC121980.2| Mus musculus BAC clone RP24-290F15 from 1, complete sequence
          Length = 129142

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 233  ctttcaccttcttgctggtg 252
            ||||||||||||||||||||
Sbjct: 4723 ctttcaccttcttgctggtg 4704
to top
>emb|AL513318.8| Human DNA sequence from clone RP11-276H19 on chromosome 9 Contains the 3'
              end of a novel gene, a novel pseudogene, CDC20 pseudogene,
              and a nuclear transcription factor Y, gamma (HSM, CBFC,
              HAP5) (NFYC) pseudogene, complete sequence
          Length = 153292

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 322    ttgttggatgaaaattttgcaaat 345
              |||||||||||| |||||||||||
Sbjct: 150179 ttgttggatgaatattttgcaaat 150156
to top
>emb|AL354982.12| Human DNA sequence from clone RP11-473H13 on chromosome 9 Contains part
              of the gene for the likely ortholog of mouse polydom
              (POLYDOM), complete sequence
          Length = 119077

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    taccagaattttaagtggaa 140
              ||||||||||||||||||||
Sbjct: 110571 taccagaattttaagtggaa 110552
to top
>emb|AL133347.28| Human DNA sequence from clone RP1-274L14 on chromosome 6q25.2-26
            Contains part of a novel gene, a signal recognition
            particle 72kD (SRP72) pseudogene and three CpG islands,
            complete sequence
          Length = 100732

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                        
Query: 320  ctttgttggatgaa-aattttgcaaatg 346
            |||||||||||||| |||||||||||||
Sbjct: 6092 ctttgttggatgaataattttgcaaatg 6065
to top
>gb|AC108924.5| Homo sapiens chromosome 8, clone RP11-1113C19, complete sequence
          Length = 125488

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   aattttaagtggaaaggaaa 146
             ||||||||||||||||||||
Sbjct: 94417 aattttaagtggaaaggaaa 94436
to top
>gb|AC155332.10| Mus musculus 6 BAC RP24-140J8 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 202181

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 210    aatgacaagaaaaaacaatt 229
              ||||||||||||||||||||
Sbjct: 107295 aatgacaagaaaaaacaatt 107314
to top
>emb|BX323543.11| Zebrafish DNA sequence from clone DKEYP-67E1 in linkage group 25,
              complete sequence
          Length = 181520

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 202    caggtccaaatgacaagaaa 221
              ||||||||||||||||||||
Sbjct: 141185 caggtccaaatgacaagaaa 141166
to top
>gb|AC116154.2| Homo sapiens chromosome 8, clone RP11-927P11, complete sequence
          Length = 196518

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 127  aattttaagtggaaaggaaa 146
            ||||||||||||||||||||
Sbjct: 3937 aattttaagtggaaaggaaa 3956
to top
>gb|AC103792.2| Homo sapiens chromosome 11, clone CTD-2384B9, complete sequence
          Length = 115626

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 89    acaaagtaaactcaggagct 108
             ||||||||||||||||||||
Sbjct: 43585 acaaagtaaactcaggagct 43566
to top
>gb|AC114284.2| Homo sapiens chromosome 5 clone CTD-2334D19, complete sequence
          Length = 126480

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 329   atgaaaattttgcaaatggg 348
             ||||||||||||||||||||
Sbjct: 54452 atgaaaattttgcaaatggg 54433
to top
>gb|AC109998.2| Homo sapiens chromosome 5 clone CTD-2203A3, complete sequence
          Length = 126394

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 208  caaatgacaagaaaaaacaa 227
            ||||||||||||||||||||
Sbjct: 1024 caaatgacaagaaaaaacaa 1005
to top
>gb|AC119156.9| Mus musculus chromosome 1, clone RP24-534J20, complete sequence
          Length = 185873

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 84    agactacaaagtaaactcag 103
             ||||||||||||||||||||
Sbjct: 64974 agactacaaagtaaactcag 64955
to top
>gb|AC091903.2| Homo sapiens chromosome 5 clone RP11-182I21, complete sequence
          Length = 194860

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 208   caaatgacaagaaaaaacaa 227
             ||||||||||||||||||||
Sbjct: 53535 caaatgacaagaaaaaacaa 53554
to top
>gb|AC158672.6| Mus musculus 6 BAC RP23-64J23 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 216954

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 210  aatgacaagaaaaaacaatt 229
            ||||||||||||||||||||
Sbjct: 1310 aatgacaagaaaaaacaatt 1329
to top
>emb|BX284697.8| Zebrafish DNA sequence from clone DKEY-7M11 in linkage group 1,
             complete sequence
          Length = 209946

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 209   aaatgacaagaaaaaacaat 228
             ||||||||||||||||||||
Sbjct: 70661 aaatgacaagaaaaaacaat 70680
to top
>gb|AC016725.5| Homo sapiens BAC clone RP11-341H1 from 2, complete sequence
          Length = 164180

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 322    ttgttggatgaaaattttgcaaat 345
              |||||||||||| |||||||||||
Sbjct: 131687 ttgttggatgaacattttgcaaat 131710
to top
>gb|AC084063.5| Homo sapiens chromosome 16 clone RP11-255J12, complete sequence
          Length = 46053

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 317   gttctttgttggatgaaaattttgcaaa 344
             |||| |||||||||||| ||||||||||
Sbjct: 19896 gttccttgttggatgaatattttgcaaa 19869
to top
>emb|AL132668.4|CNS01DT9 Human chromosome 14 DNA sequence BAC R-550M19 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 175725

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    atgacaagaaaaaacaatta 230
              ||||||||||||||||||||
Sbjct: 137047 atgacaagaaaaaacaatta 137066
to top
>gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome
          Length = 1767403

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 217    agaaaaaacaattatacttt 236
              ||||||||||||||||||||
Sbjct: 767198 agaaaaaacaattatacttt 767217
to top
>gb|AC111089.27| Mus musculus chromosome 5, clone RP23-156F20, complete sequence
          Length = 211658

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 121   taccagaattttaagtggaa 140
             ||||||||||||||||||||
Sbjct: 86438 taccagaattttaagtggaa 86457
to top
>dbj|AP004287.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1471H7
          Length = 172543

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   aattttaagtggaaaggaaa 146
             ||||||||||||||||||||
Sbjct: 99047 aattttaagtggaaaggaaa 99066


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,482,728
Number of Sequences: 3902068
Number of extensions: 4482728
Number of successful extensions: 95716
Number of sequences better than 10.0: 39
Number of HSP's better than 10.0 without gapping: 38
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 95608
Number of HSP's gapped (non-prelim): 109
length of query: 366
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 344
effective length of database: 17,147,199,772
effective search space: 5898636721568
effective search space used: 5898636721568
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top