Clone Name	rbastl16h04
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AC124450.3| Mus musculus BAC clone RP24-215C4 from chromosome...	42	0.50
2	emb|AL691457.14| Mouse DNA sequence from clone RP23-17M4 on chro...	40	2.0
3	gb|AC009507.3| Homo sapiens BAC clone RP11-543L11 from 2, comple...	40	2.0
4	gb|AC092623.2| Homo sapiens BAC clone RP11-260E12 from 2, comple...	40	2.0
5	gb|AC165353.4| Mus musculus BAC clone RP23-167C2 from chromosome...	38	7.8
6	ref|XM_467482.1| Oryza sativa (japonica cultivar-group), mRNA	38	7.8
7	gb|AY584531.1| Helicobacter pylori plasmid pAL202, complete sequ...	38	7.8
8	gb|AC115738.9| Mus musculus chromosome 3, clone RP23-474P24, com...	38	7.8
9	gb|AC131765.3| Mus musculus BAC clone RP24-240I9 from chromosome...	38	7.8
10	ref|XM_801876.1| Trypanosoma cruzi strain CL Brener hypothetical...	38	7.8
11	gb|AC125518.3| Mus musculus BAC clone RP24-267E6 from chromosome...	38	7.8
12	gb|AC123935.4| Mus musculus BAC clone RP23-354J3 from chromosome...	38	7.8
13	ref|XM_807635.1| Trypanosoma cruzi strain CL Brener hypothetical...	38	7.8
14	gb|AF469112.1| Helicobacter pylori plasmid pHel4 complete sequence	38	7.8
15	gb|AC158622.4| Mus musculus 10 BAC RP23-292G1 (Roswell Park Canc...	38	7.8
16	emb|AJ852426.1| Mus musculus domesticus VpreB1 gene and Lambda5 ...	38	7.8
17	gb|AC157019.8| Mus musculus 10 BAC RP24-377N13 (Roswell Park Can...	38	7.8
18	emb|AL596255.17| Mouse DNA sequence from clone RP23-6K20 on chro...	38	7.8
19	ref|NM_001000253.1| Rattus norvegicus olfactory receptor 340 (pr...	38	7.8
20	gb|AC117372.2| Homo sapiens 12 BAC RP11-266O15 (Roswell Park Can...	38	7.8
21	gb|AC121336.3| Homo sapiens 12 BAC RP11-134P3 (Roswell Park Canc...	38	7.8
22	gb|AC154646.2| Mus musculus BAC clone RP23-283B12 from chromosom...	38	7.8
23	emb|CR386768.1| Gallus gallus finished cDNA, clone ChEST423g17	38	7.8
24	gb|U19464.1|PTU19464 Paramecium tetraurelia outer arm dynein bet...	38	7.8
25	gb|AC007351.40|AC007351 Homo sapiens 12 BAC RP11-492N15 (Roswell...	38	7.8
26	dbj|AB205158.1| Geotria australis CNP mRNA for C-type natriureti...	38	7.8
27	gb|AC013423.6|AC013423 Drosophila melanogaster, chromosome 2R, r...	38	7.8
28	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	38	7.8
29	gb|AC008187.6|AC008187 Drosophila melanogaster, chromosome 2R, r...	38	7.8
30	gb|AC154436.2| Mus musculus BAC clone RP24-192B24 from chromosom...	38	7.8
31	dbj|AP004098.3| Oryza sativa (japonica cultivar-group) genomic D...	38	7.8
32	dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic D...	38	7.8
33	dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome	38	7.8
34	emb|AL807827.11| Zebrafish DNA sequence from clone CH211-220J6, ...	38	7.8
35	dbj|AK121612.1| Oryza sativa (japonica cultivar-group) cDNA clon...	38	7.8
36	gb|AC108828.17| Mus musculus chromosome 5, clone RP23-153H17, co...	38	7.8
37	gb|AE003826.4| Drosophila melanogaster chromosome 2R, section 24...	38	7.8
38	emb|CR925730.6| Zebrafish DNA sequence from clone DKEY-277M11 in...	38	7.8
39	gb|AC132137.3| Mus musculus BAC clone RP23-153E2 from 3, complet...	38	7.8
40	gb|AC149591.5| Mus musculus BAC clone RP23-332I9 from 18, comple...	38	7.8
41	emb|CR962121.2| Medicago truncatula chromosome 5 clone mte1-77f5...	38	7.8
42	emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB1...	38	7.8
43	emb|AL356807.3|CNS05TDP Human chromosome 14 DNA sequence BAC C-2...	38	7.8

---

>gb|AC124450.3| Mus musculus BAC clone RP24-215C4 from chromosome 13, complete sequence
          Length = 157531

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 87    acccccaccccaccacaaataaaat 111
             |||||||||||||| ||||||||||
Sbjct: 75543 acccccaccccaccccaaataaaat 75519

---

>emb|AL691457.14| Mouse DNA sequence from clone RP23-17M4 on chromosome 11 Contains the 3'
              end of a novel gene, complete sequence
          Length = 162777

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 79     ttctacaaacccccacccca 98
              ||||||||||||||||||||
Sbjct: 153252 ttctacaaacccccacccca 153233

---

>gb|AC009507.3| Homo sapiens BAC clone RP11-543L11 from 2, complete sequence
          Length = 122213

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    cccccaccccaccacaaata 107
             ||||||||||||||||||||
Sbjct: 26226 cccccaccccaccacaaata 26207

---

>gb|AC092623.2| Homo sapiens BAC clone RP11-260E12 from 2, complete sequence
          Length = 172344

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    aacccccaccccaccacaaa 105
             ||||||||||||||||||||
Sbjct: 16323 aacccccaccccaccacaaa 16304

---

>gb|AC165353.4| Mus musculus BAC clone RP23-167C2 from chromosome 3, complete sequence
          Length = 198393

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 51     ctcgtggctattattttta 69
              |||||||||||||||||||
Sbjct: 153209 ctcgtggctattattttta 153191

---

>ref|XM_467482.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 4672

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                   
Query: 101  acaaataaaattactctgccactatggggacgtgacaat 139
            ||||| |||||||||||||||| |||  | |||||||||
Sbjct: 4520 acaaacaaaattactctgccaccatgctggcgtgacaat 4482

---

>gb|AY584531.1| Helicobacter pylori plasmid pAL202, complete sequence
          Length = 12120

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 56   ggctattatttttatggca 74
            |||||||||||||||||||
Sbjct: 2784 ggctattatttttatggca 2802

---

>gb|AC115738.9| Mus musculus chromosome 3, clone RP23-474P24, complete sequence
          Length = 188507

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 83    acaaacccccaccccacca 101
             |||||||||||||||||||
Sbjct: 75051 acaaacccccaccccacca 75033

---

>gb|AC131765.3| Mus musculus BAC clone RP24-240I9 from chromosome 1, complete sequence
          Length = 152666

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 63     atttttatggcactcattc 81
              |||||||||||||||||||
Sbjct: 131429 atttttatggcactcattc 131411

---

>ref|XM_801876.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053511111.30) partial mRNA
          Length = 2325

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 52   tcgtggctattatttttat 70
            |||||||||||||||||||
Sbjct: 1451 tcgtggctattatttttat 1433

---

>gb|AC125518.3| Mus musculus BAC clone RP24-267E6 from chromosome 1, complete sequence
          Length = 174190

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 63    atttttatggcactcattc 81
             |||||||||||||||||||
Sbjct: 22366 atttttatggcactcattc 22348

---

>gb|AC123935.4| Mus musculus BAC clone RP23-354J3 from chromosome 13, complete sequence
          Length = 219370

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 88    cccccaccccaccacaaataaaa 110
             ||||||||||||| |||||||||
Sbjct: 76768 cccccaccccaccccaaataaaa 76746

---

>ref|XM_807635.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053507715.100) partial mRNA
          Length = 1273

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 52  tcgtggctattatttttat 70
           |||||||||||||||||||
Sbjct: 399 tcgtggctattatttttat 381

---

>gb|AF469112.1| Helicobacter pylori plasmid pHel4 complete sequence
          Length = 10970

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 56   ggctattatttttatggca 74
            |||||||||||||||||||
Sbjct: 9051 ggctattatttttatggca 9069

---

>gb|AC158622.4| Mus musculus 10 BAC RP23-292G1 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 232339

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 103   aaataaaattactctgcca 121
             |||||||||||||||||||
Sbjct: 29212 aaataaaattactctgcca 29194

---

>emb|AJ852426.1| Mus musculus domesticus VpreB1 gene and Lambda5 gene
          Length = 18322

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 85   aaacccccaccccaccaca 103
            |||||||||||||||||||
Sbjct: 6360 aaacccccaccccaccaca 6342

---

>gb|AC157019.8| Mus musculus 10 BAC RP24-377N13 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 233155

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 80     tctacaaacccccacccca 98
              |||||||||||||||||||
Sbjct: 166502 tctacaaacccccacccca 166520

---

>emb|AL596255.17| Mouse DNA sequence from clone RP23-6K20 on chromosome 11 Contains the 3'
              end of the Myh13 gene for skeletal muscle myosin heavy
              polypeptide 13, the 5' end of the Gas7 gene for growth
              arrest specific 7, a novel gene and a CpG island, complete
              sequence
          Length = 251096

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 88     cccccaccccaccacaaat 106
              |||||||||||||||||||
Sbjct: 137954 cccccaccccaccacaaat 137936

---

>ref|NM_001000253.1| Rattus norvegicus olfactory receptor 340 (predicted)
           (Olr340_predicted), mRNA
          Length = 945

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 93  accccaccacaaataaaat 111
           |||||||||||||||||||
Sbjct: 607 accccaccacaaataaaat 589

---

>gb|AC117372.2| Homo sapiens 12 BAC RP11-266O15 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 165301

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 103    aaataaaattactctgcca 121
              |||||||||||||||||||
Sbjct: 127232 aaataaaattactctgcca 127250

---

>gb|AC121336.3| Homo sapiens 12 BAC RP11-134P3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 171437

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 91    ccaccccaccacaaataaaatta 113
             |||||||||||||| ||||||||
Sbjct: 55285 ccaccccaccacaattaaaatta 55263

---

>gb|AC154646.2| Mus musculus BAC clone RP23-283B12 from chromosome 14, complete
            sequence
          Length = 189102

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 88   cccccaccccaccacaaataaaa 110
            ||||||||||||| |||||||||
Sbjct: 1995 cccccaccccaccccaaataaaa 1973

---

>emb|CR386768.1| Gallus gallus finished cDNA, clone ChEST423g17
          Length = 699

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 138 atccctatgggccaaaaaa 156
           |||||||||||||||||||
Sbjct: 62  atccctatgggccaaaaaa 44

---

>gb|U19464.1|PTU19464 Paramecium tetraurelia outer arm dynein beta heavy chain gene,
           complete cds
          Length = 16556

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 54  gtggctattatttttatgg 72
           |||||||||||||||||||
Sbjct: 395 gtggctattatttttatgg 377

---

>gb|AC007351.40|AC007351 Homo sapiens 12 BAC RP11-492N15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 195501

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 105   ataaaattactctgccact 123
             |||||||||||||||||||
Sbjct: 19791 ataaaattactctgccact 19773

---

>dbj|AB205158.1| Geotria australis CNP mRNA for C-type natriuretic peptide, complete
           cds
          Length = 1056

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 84  caaacccccaccccaccac 102
           |||||||||||||||||||
Sbjct: 628 caaacccccaccccaccac 646

---

>gb|AC013423.6|AC013423 Drosophila melanogaster, chromosome 2R, region 47D-47E, BAC clone
             BACR09B12, complete sequence
          Length = 170341

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 60    attatttttatggcactca 78
             |||||||||||||||||||
Sbjct: 42384 attatttttatggcactca 42402

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                       
Query: 101      acaaataaaattactctgccactatggggacgtgacaat 139
                ||||| |||||||||||||||| |||  | |||||||||
Sbjct: 29782267 acaaacaaaattactctgccaccatgctggcgtgacaat 29782305

---

>gb|AC008187.6|AC008187 Drosophila melanogaster, chromosome 2R, region 47D-47E, BAC clone
              BACR13D20, complete sequence
          Length = 168417

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 60     attatttttatggcactca 78
              |||||||||||||||||||
Sbjct: 160728 attatttttatggcactca 160746

---

>gb|AC154436.2| Mus musculus BAC clone RP24-192B24 from chromosome 14, complete sequence
          Length = 180476

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 88     cccccaccccaccacaaataaaa 110
              ||||||||||||| |||||||||
Sbjct: 166978 cccccaccccaccccaaataaaa 166956

---

>dbj|AP004098.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ2056_H01
          Length = 123428

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                    
Query: 101   acaaataaaattactctgccactatggggacgtgacaat 139
             ||||| |||||||||||||||| |||  | |||||||||
Sbjct: 38612 acaaacaaaattactctgccaccatgctggcgtgacaat 38650

---

>dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1191_G08
          Length = 172832

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                     
Query: 101    acaaataaaattactctgccactatggggacgtgacaat 139
              ||||| |||||||||||||||| |||  | |||||||||
Sbjct: 151246 acaaacaaaattactctgccaccatgctggcgtgacaat 151284

---

>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 97      caccacaaataaaattact 115
               |||||||||||||||||||
Sbjct: 2682352 caccacaaataaaattact 2682334

---

>emb|AL807827.11| Zebrafish DNA sequence from clone CH211-220J6, complete sequence
          Length = 199141

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     catcaatcagcagtcccac 25
             |||||||||||||||||||
Sbjct: 95212 catcaatcagcagtcccac 95230

---

>dbj|AK121612.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033043J17, full
            insert sequence
          Length = 4673

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                   
Query: 101  acaaataaaattactctgccactatggggacgtgacaat 139
            ||||| |||||||||||||||| |||  | |||||||||
Sbjct: 4521 acaaacaaaattactctgccaccatgctggcgtgacaat 4483

---

>gb|AC108828.17| Mus musculus chromosome 5, clone RP23-153H17, complete sequence
          Length = 218103

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 130   acgtgacaatccctatgggccaa 152
             |||||||| ||||||||||||||
Sbjct: 80847 acgtgacattccctatgggccaa 80825

---

>gb|AE003826.4| Drosophila melanogaster chromosome 2R, section 24 of 73 of the complete
             sequence
          Length = 310108

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 60    attatttttatggcactca 78
             |||||||||||||||||||
Sbjct: 16678 attatttttatggcactca 16696

---

>emb|CR925730.6| Zebrafish DNA sequence from clone DKEY-277M11 in linkage group 10,
            complete sequence
          Length = 34855

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 87   acccccaccccaccacaaa 105
            |||||||||||||||||||
Sbjct: 8759 acccccaccccaccacaaa 8741

---

>gb|AC132137.3| Mus musculus BAC clone RP23-153E2 from 3, complete sequence
          Length = 196413

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 51     ctcgtggctattattttta 69
              |||||||||||||||||||
Sbjct: 166565 ctcgtggctattattttta 166583

---

>gb|AC149591.5| Mus musculus BAC clone RP23-332I9 from 18, complete sequence
          Length = 231381

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 107    aaaattactctgccactat 125
              |||||||||||||||||||
Sbjct: 138760 aaaattactctgccactat 138742

---

>emb|CR962121.2| Medicago truncatula chromosome 5 clone mte1-77f5, COMPLETE SEQUENCE
          Length = 107392

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 88     cccccaccccaccacaaat 106
              |||||||||||||||||||
Sbjct: 101167 cccccaccccaccacaaat 101185

---

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 66     tttatggcactcattctacaaac 88
              |||||||||||||| ||||||||
Sbjct: 367154 tttatggcactcatactacaaac 367176

---

>emb|AL356807.3|CNS05TDP Human chromosome 14 DNA sequence BAC C-2335K5 of library CalTech-D from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 124620

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 34    tttgccttcaccccattct 52
             |||||||||||||||||||
Sbjct: 99286 tttgccttcaccccattct 99268


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,094,173
Number of Sequences: 3902068
Number of extensions: 2094173
Number of successful extensions: 151782
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 151604
Number of HSP's gapped (non-prelim): 178
length of query: 161
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 139
effective length of database: 17,147,199,772
effective search space: 2383460768308
effective search space used: 2383460768308
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)

---