ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl16g06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 50 0.003
2ref|XM_758173.1| Theileria parva strain Muguga chromosome 3 hypo... 44 0.17
3ref|XM_647515.1| Entamoeba histolytica HM-1:IMSS conserved hypot... 42 0.66
4gb|AC006069.3| Arabidopsis thaliana chromosome 2 clone T8O11 map... 42 0.66
5gb|AC159333.7| Mus musculus 10 BAC RP23-409C14 (Roswell Park Can... 42 0.66
6ref|XM_223830.3| PREDICTED: Rattus norvegicus similar to hypothe... 42 0.66
7gb|AC166819.2| Mus musculus BAC clone RP24-492L15 from chromosom... 40 2.6
8gb|AC115881.8| Mus musculus chromosome 6, clone RP24-365K16, com... 40 2.6
9gb|AC121600.2| Mus musculus BAC clone RP23-302K1 from 17, comple... 40 2.6
10emb|AL353765.3| Human DNA sequence from clone RP11-429G17 on chr... 40 2.6
11emb|Z49811.1|SPAC5H10 S.pombe chromosome I cosmid c5H10 40 2.6
12emb|BX571658.1| Wolinella succinogenes, complete genome; segment... 40 2.6
13gb|AC157978.25| Medicago truncatula clone mth2-47l16, complete s... 40 2.6
14gb|AY135690.1| Mus musculus argonaute 4 protein (Ago4) gene, com... 40 2.6
15dbj|AB020746.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 2.6
16emb|Y09448.1|PV09448 P.vulgaris immature mRNA for cinnamate 4-hy... 40 2.6
17emb|Y09447.1|PV09447 P.vulgaris mRNA for cinnamate 4-hydroxylase 40 2.6
18emb|CT033752.6| Mouse DNA sequence from clone RP23-140I20 on chr... 40 2.6
19emb|AL713981.17| Mouse DNA sequence from clone RP23-173O12 on ch... 40 2.6
20emb|AL606935.8| Mouse DNA sequence from clone RP23-204N19 on chr... 40 2.6

>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 1     ttttaagcttttgattcttcaaacccagaatca 33
             |||||||||||||||| |||||||||| |||||
Sbjct: 55871 ttttaagcttttgatttttcaaacccaaaatca 55903



to top

>ref|XM_758173.1| Theileria parva strain Muguga chromosome 3 hypothetical protein
           (TP03_0248) partial mRNA
          Length = 1479

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 16  tcttcaaacccagaatcatcat 37
           ||||||||||||||||||||||
Sbjct: 566 tcttcaaacccagaatcatcat 545



to top

>ref|XM_647515.1| Entamoeba histolytica HM-1:IMSS conserved hypothetical protein
           (112.t00011) partial mRNA
          Length = 1839

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 10  tttgattcttcaaacccagaa 30
           |||||||||||||||||||||
Sbjct: 515 tttgattcttcaaacccagaa 495



to top

>gb|AC006069.3| Arabidopsis thaliana chromosome 2 clone T8O11 map rga, complete
             sequence
          Length = 89138

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 11    ttgattcttcaaacccagaat 31
             |||||||||||||||||||||
Sbjct: 38545 ttgattcttcaaacccagaat 38525



to top

>gb|AC159333.7| Mus musculus 10 BAC RP23-409C14 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 201801

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 142   aaatccagttttctccacata 162
             |||||||||||||||||||||
Sbjct: 97707 aaatccagttttctccacata 97687



to top

>ref|XM_223830.3| PREDICTED: Rattus norvegicus similar to hypothetical protein
           FLJ23834 (LOC289926), mRNA
          Length = 2331

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 141 caaatccagttttctccacat 161
           |||||||||||||||||||||
Sbjct: 898 caaatccagttttctccacat 878



to top

>gb|AC166819.2| Mus musculus BAC clone RP24-492L15 from chromosome 6, complete sequence
          Length = 199206

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 89     tatttcactaaaaattaaag 108
              ||||||||||||||||||||
Sbjct: 193816 tatttcactaaaaattaaag 193835



to top

>gb|AC115881.8| Mus musculus chromosome 6, clone RP24-365K16, complete sequence
          Length = 164311

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 89    tatttcactaaaaattaaag 108
             ||||||||||||||||||||
Sbjct: 34589 tatttcactaaaaattaaag 34608



to top

>gb|AC121600.2| Mus musculus BAC clone RP23-302K1 from 17, complete sequence
          Length = 199296

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 135   ataatccaaatccagttttctcca 158
             ||||||||||| ||||||||||||
Sbjct: 17998 ataatccaaatgcagttttctcca 18021



to top

>emb|AL353765.3| Human DNA sequence from clone RP11-429G17 on chromosome 13 Contains a
              ras-related C3 botulinum toxin substrate 1 (rho family,
              small GTP binding protein Rac1) (RAC1) pseudogene, complete
              sequence
          Length = 164831

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     tagcctatttcactaaaaattaaa 107
              |||| |||||||||||||||||||
Sbjct: 109569 tagcttatttcactaaaaattaaa 109546



to top

>emb|Z49811.1|SPAC5H10 S.pombe chromosome I cosmid c5H10
          Length = 24845

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 88    ctatttcactaaaaattaaa 107
             ||||||||||||||||||||
Sbjct: 12523 ctatttcactaaaaattaaa 12542



to top

>emb|BX571658.1| Wolinella succinogenes, complete genome; segment 2/7
          Length = 346792

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     ttttaagcttttgattcttc 20
             ||||||||||||||||||||
Sbjct: 51181 ttttaagcttttgattcttc 51200



to top

>gb|AC157978.25| Medicago truncatula clone mth2-47l16, complete sequence
          Length = 125021

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 95    actaaaaattaaagggaaacgttt 118
             ||||||||| ||||||||||||||
Sbjct: 42747 actaaaaatcaaagggaaacgttt 42770



to top

>gb|AY135690.1| Mus musculus argonaute 4 protein (Ago4) gene, complete cds
          Length = 92047

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 151   tttctccacatacacaaaaa 170
             ||||||||||||||||||||
Sbjct: 52373 tttctccacatacacaaaaa 52354



to top

>dbj|AB020746.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MOB24
          Length = 79706

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                         
Query: 96    ctaaaaattaaagggaa-acgtttgaga 122
             ||||||||||||||||| ||||||||||
Sbjct: 13778 ctaaaaattaaagggaagacgtttgaga 13751



to top

>emb|Y09448.1|PV09448 P.vulgaris immature mRNA for cinnamate 4-hydroxylase, partial
          Length = 2280

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 156 ccacatacacaaaaatgagt 175
           ||||||||||||||||||||
Sbjct: 1   ccacatacacaaaaatgagt 20



to top

>emb|Y09447.1|PV09447 P.vulgaris mRNA for cinnamate 4-hydroxylase
          Length = 1799

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 156 ccacatacacaaaaatgagt 175
           ||||||||||||||||||||
Sbjct: 1   ccacatacacaaaaatgagt 20



to top

>emb|CT033752.6| Mouse DNA sequence from clone RP23-140I20 on chromosome 17, complete
              sequence
          Length = 216455

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 135    ataatccaaatccagttttctcca 158
              ||||||||||| ||||||||||||
Sbjct: 185961 ataatccaaatgcagttttctcca 185984



to top

>emb|AL713981.17| Mouse DNA sequence from clone RP23-173O12 on chromosome 2, complete
              sequence
          Length = 223609

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 120    agaacatagccattcataat 139
              ||||||||||||||||||||
Sbjct: 127293 agaacatagccattcataat 127274



to top

>emb|AL606935.8| Mouse DNA sequence from clone RP23-204N19 on chromosome 4, complete
             sequence
          Length = 213391

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 151   tttctccacatacacaaaaa 170
             ||||||||||||||||||||
Sbjct: 65792 tttctccacatacacaaaaa 65811


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,533,737
Number of Sequences: 3902068
Number of extensions: 2533737
Number of successful extensions: 174909
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 174862
Number of HSP's gapped (non-prelim): 48
length of query: 206
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 184
effective length of database: 17,147,199,772
effective search space: 3155084758048
effective search space used: 3155084758048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top