Clone Name | rbastl16g02 |
---|---|
Clone Library Name | barley_pub |
>gb|DQ351213.1| Hordeum vulgare subsp. vulgare resistance protein (ABC1037) gene, complete cds Length = 25080 Score = 153 bits (77), Expect = 2e-34 Identities = 77/77 (100%) Strand = Plus / Minus Query: 85 tggtagaggctagggttctaccaggtctcggacgtaggttgtaggggtggaagtgcgggc 144 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18982 tggtagaggctagggttctaccaggtctcggacgtaggttgtaggggtggaagtgcgggc 18923 Query: 145 tgcgaggttggggacgc 161 ||||||||||||||||| Sbjct: 18922 tgcgaggttggggacgc 18906
>ref|XM_587647.2| PREDICTED: Bos taurus similar to GRIP and coiled-coil domain-containing 2 isoform a (LOC539484), partial mRNA Length = 5264 Score = 42.1 bits (21), Expect = 0.50 Identities = 21/21 (100%) Strand = Plus / Plus Query: 128 ggggtggaagtgcgggctgcg 148 ||||||||||||||||||||| Sbjct: 182 ggggtggaagtgcgggctgcg 202
>ref|XM_647304.1| Entamoeba histolytica HM-1:IMSS predicted protein (119.t00029) partial mRNA Length = 924 Score = 40.1 bits (20), Expect = 2.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 26 ctcctttcgatttatcaagt 45 |||||||||||||||||||| Sbjct: 545 ctcctttcgatttatcaagt 564
>gb|AC007419.7| Drosophila melanogaster, chromosome 2L, region 25E-25F, BAC clone BACR07G15, complete sequence Length = 190668 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 30 tttcgatttatcaagtttgacaac 53 ||||||||||| |||||||||||| Sbjct: 104139 tttcgatttataaagtttgacaac 104162
>gb|AE003611.3| Drosophila melanogaster chromosome 2L, section 20 of 83 of the complete sequence Length = 260731 Score = 40.1 bits (20), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 30 tttcgatttatcaagtttgacaac 53 ||||||||||| |||||||||||| Sbjct: 56845 tttcgatttataaagtttgacaac 56822
>gb|AC153801.1| Mus musculus 10 NOVECTOR RP24-255E19 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 156755 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 71 aaacagtgtctggatggta 89 ||||||||||||||||||| Sbjct: 3500 aaacagtgtctggatggta 3518
>ref|NM_175768.1| Homo sapiens glutamate receptor, ionotropic, kainate 2 (GRIK2), transcript variant 2, mRNA Length = 3409 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 aaacagtgtctggatggta 89 ||||||||||||||||||| Sbjct: 2808 aaacagtgtctggatggta 2790
>gb|AC124985.16| Mus musculus chromosome 8, clone RP24-230O22, complete sequence Length = 171213 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Plus Query: 118 gtaggttgtaggggtggaagtgc 140 |||||||||||||||| |||||| Sbjct: 130223 gtaggttgtaggggtgaaagtgc 130245
>ref|XM_583040.2| PREDICTED: Bos taurus similar to leucine-rich repeats and immunoglobulin-like domains 3 (LOC506574), mRNA Length = 4308 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 122 gttgtaggggtggaagtgc 140 ||||||||||||||||||| Sbjct: 1048 gttgtaggggtggaagtgc 1030
>ref|NM_010349.1| Mus musculus glutamate receptor, ionotropic, kainate 2 (beta 2) (Grik2), mRNA Length = 3109 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 aaacagtgtctggatggta 89 ||||||||||||||||||| Sbjct: 2758 aaacagtgtctggatggta 2740
>gb|AC158556.9| Mus musculus chromosome 15, clone RP23-140F20, complete sequence Length = 203053 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 89 agaggctagggttctacca 107 ||||||||||||||||||| Sbjct: 199009 agaggctagggttctacca 199027
>gb|AC113305.7| Mus musculus chromosome 10, clone RP23-433H22, complete sequence Length = 203296 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 aaacagtgtctggatggta 89 ||||||||||||||||||| Sbjct: 2639 aaacagtgtctggatggta 2621
>gb|AC127356.4| Mus musculus BAC clone RP23-100B5 from chromosome 8, complete sequence Length = 199258 Score = 38.2 bits (19), Expect = 7.8 Identities = 22/23 (95%) Strand = Plus / Minus Query: 118 gtaggttgtaggggtggaagtgc 140 |||||||||||||||| |||||| Sbjct: 194110 gtaggttgtaggggtgaaagtgc 194088
>gb|AC004519.1| Homo sapiens BAC clone CTB-41H4 from 7, complete sequence Length = 107889 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 67 tgcaaaacagtgtctggat 85 ||||||||||||||||||| Sbjct: 66102 tgcaaaacagtgtctggat 66084
>emb|AL355490.24| Human DNA sequence from clone RP11-452K12 on chromosome 10 Contains the FRAT1 gene for frequently rearranged in advanced T-cell lymphomas, the FRAT2 gene for frequently rearranged in advanced T-cell lymphomas 2, two novel genes, the gene for a novel protein (FLJ12434,KIAA0690), the PGAM1 gene for phosphoglycerate mutase 1 (brain), the CSL4 gene for exosomal core protein CSL4, the ZDHHC16 gene for zinc finger, DHHC domain containing 16, the 3' end of the MMS19L gene for MMS19-like (MET18 homolog, S. cerevisiae), a ribosomal protein L12 (RPL12) pseudogene, a ribosomal protein L34 (RPL34) pseudogene and four CpG islands, complete sequence Length = 190803 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 cccaggggaacctcctttc 33 ||||||||||||||||||| Sbjct: 98227 cccaggggaacctcctttc 98245
>emb|X66117.1|MMGLUR6C M.musculus mRNA for glutamate receptor subunit GluR6-2 Length = 3109 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 aaacagtgtctggatggta 89 ||||||||||||||||||| Sbjct: 2758 aaacagtgtctggatggta 2740
>emb|AL355532.10| Human DNA sequence from clone RP11-487F5 on chromosome 6 Contains the 3' part of the GRIK2 (glutamate receptor, ionotropic, kainate 2) gene, ESTs, STSs and GSSs, complete sequence Length = 181302 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 aaacagtgtctggatggta 89 ||||||||||||||||||| Sbjct: 112708 aaacagtgtctggatggta 112690
>emb|AJ301610.1|HSA301610 Homo sapiens mRNA for GluR6 kainate receptor (GRIK2 gene), isoform-b Length = 2692 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 aaacagtgtctggatggta 89 ||||||||||||||||||| Sbjct: 2608 aaacagtgtctggatggta 2590
>gb|AC159091.2| Mus musculus chromosome 15, clone RP24-283J18, complete sequence Length = 65063 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 89 agaggctagggttctacca 107 ||||||||||||||||||| Sbjct: 56387 agaggctagggttctacca 56369
>tpg|BK003828.1| TPA: TPA_inf: Drosophila melanogaster HDC06590 (HDC06590) gene, complete cds Length = 5191 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 127 aggggtggaagtgcgggct 145 ||||||||||||||||||| Sbjct: 4737 aggggtggaagtgcgggct 4719
>gb|AC097535.3| Homo sapiens BAC clone RP11-802H3 from 4, complete sequence Length = 72759 Score = 38.2 bits (19), Expect = 7.8 Identities = 25/27 (92%) Strand = Plus / Plus Query: 23 aacctcctttcgatttatcaagtttga 49 ||||||||||| ||||| ||||||||| Sbjct: 8425 aacctcctttcaatttaccaagtttga 8451
>gb|AY634681.1| Hordeum vulgare ADP-glucose pyrophosphorylase small subunit gene, complete cds, alternatively spliced Length = 9669 Score = 38.2 bits (19), Expect = 7.8 Identities = 34/39 (87%) Strand = Plus / Plus Query: 93 gctagggttctaccaggtctcggacgtaggttgtagggg 131 |||| ||||||||| ||||| || || |||||||||||| Sbjct: 7890 gctaaggttctaccgggtctagggcggaggttgtagggg 7928
>gb|AF446141.1| Aegilops tauschii LZ-NBS-LRR class RGA, NBS-LRR class RGA, HCBT-like putative defense response protein, and putative alliin lyase genes, complete cds; and unknown genes Length = 106618 Score = 38.2 bits (19), Expect = 7.8 Identities = 34/39 (87%) Strand = Plus / Plus Query: 93 gctagggttctaccaggtctcggacgtaggttgtagggg 131 ||||||||||| || ||||| || |||||| |||||||| Sbjct: 96008 gctagggttctgcccggtctaggccgtaggctgtagggg 96046
>dbj|AB083077.1| Oryzias latipes DNA, globin gene cluster region Length = 47119 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 64 ttttgcaaaacagtgtctg 82 ||||||||||||||||||| Sbjct: 637 ttttgcaaaacagtgtctg 619
>gb|AC008369.1|AC008369 Drosophila melanogaster, chromosome 2R, region 52A4-52B4, P1 clones BACR48C01 and DS08592, complete sequence Length = 192366 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 127 aggggtggaagtgcgggct 145 ||||||||||||||||||| Sbjct: 95520 aggggtggaagtgcgggct 95502
>gb|AE003810.3| Drosophila melanogaster chromosome 2R, section 40 of 73 of the complete sequence Length = 271178 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 127 aggggtggaagtgcgggct 145 ||||||||||||||||||| Sbjct: 172878 aggggtggaagtgcgggct 172860
>emb|AL117693.5|CNS01DRO Human chromosome 14 DNA sequence BAC R-562L8 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 179598 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 49 acaacactccaaatctttt 67 ||||||||||||||||||| Sbjct: 35134 acaacactccaaatctttt 35116
>dbj|AP006297.1| Homo sapiens genomic DNA, chromosome 6 clone:RP11-645B4, complete sequence Length = 168768 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 aaacagtgtctggatggta 89 ||||||||||||||||||| Sbjct: 46938 aaacagtgtctggatggta 46920
>gb|AC164092.3| Mus musculus BAC clone RP23-366E4 from chromosome 9, complete sequence Length = 203636 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 85 tggtagaggctagggttct 103 ||||||||||||||||||| Sbjct: 118704 tggtagaggctagggttct 118686
>dbj|AP002530.2| Homo sapiens genomic DNA, chromosome 6q21, anti-oncogene region, section 3/4 Length = 300000 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 aaacagtgtctggatggta 89 ||||||||||||||||||| Sbjct: 234915 aaacagtgtctggatggta 234897
>dbj|AB041340.1| Homo sapiens genomic DNA, chromosome 6q21, clone:553P24, complete sequence Length = 128241 Score = 38.2 bits (19), Expect = 7.8 Identities = 19/19 (100%) Strand = Plus / Minus Query: 71 aaacagtgtctggatggta 89 ||||||||||||||||||| Sbjct: 61904 aaacagtgtctggatggta 61886 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,113,843 Number of Sequences: 3902068 Number of extensions: 1113843 Number of successful extensions: 77841 Number of sequences better than 10.0: 31 Number of HSP's better than 10.0 without gapping: 31 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 77798 Number of HSP's gapped (non-prelim): 43 length of query: 161 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 139 effective length of database: 17,147,199,772 effective search space: 2383460768308 effective search space used: 2383460768308 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)