ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl16g02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DQ351213.1| Hordeum vulgare subsp. vulgare resistance protein... 153 2e-34
2ref|XM_587647.2| PREDICTED: Bos taurus similar to GRIP and coile... 42 0.50
3ref|XM_647304.1| Entamoeba histolytica HM-1:IMSS predicted prote... 40 2.0
4gb|AC007419.7| Drosophila melanogaster, chromosome 2L, region 25... 40 2.0
5gb|AE003611.3| Drosophila melanogaster chromosome 2L, section 20... 40 2.0
6gb|AC153801.1| Mus musculus 10 NOVECTOR RP24-255E19 (Roswell Par... 38 7.8
7ref|NM_175768.1| Homo sapiens glutamate receptor, ionotropic, ka... 38 7.8
8gb|AC124985.16| Mus musculus chromosome 8, clone RP24-230O22, co... 38 7.8
9ref|XM_583040.2| PREDICTED: Bos taurus similar to leucine-rich r... 38 7.8
10ref|NM_010349.1| Mus musculus glutamate receptor, ionotropic, ka... 38 7.8
11gb|AC158556.9| Mus musculus chromosome 15, clone RP23-140F20, co... 38 7.8
12gb|AC113305.7| Mus musculus chromosome 10, clone RP23-433H22, co... 38 7.8
13gb|AC127356.4| Mus musculus BAC clone RP23-100B5 from chromosome... 38 7.8
14gb|AC004519.1| Homo sapiens BAC clone CTB-41H4 from 7, complete ... 38 7.8
15emb|AL355490.24| Human DNA sequence from clone RP11-452K12 on ch... 38 7.8
16emb|X66117.1|MMGLUR6C M.musculus mRNA for glutamate receptor sub... 38 7.8
17emb|AL355532.10| Human DNA sequence from clone RP11-487F5 on chr... 38 7.8
18emb|AJ301610.1|HSA301610 Homo sapiens mRNA for GluR6 kainate rec... 38 7.8
19gb|AC159091.2| Mus musculus chromosome 15, clone RP24-283J18, co... 38 7.8
20tpg|BK003828.1| TPA: TPA_inf: Drosophila melanogaster HDC06590 (... 38 7.8
21gb|AC097535.3| Homo sapiens BAC clone RP11-802H3 from 4, complet... 38 7.8
22gb|AY634681.1| Hordeum vulgare ADP-glucose pyrophosphorylase sma... 38 7.8
23gb|AF446141.1| Aegilops tauschii LZ-NBS-LRR class RGA, NBS-LRR c... 38 7.8
24dbj|AB083077.1| Oryzias latipes DNA, globin gene cluster region 38 7.8
25gb|AC008369.1|AC008369 Drosophila melanogaster, chromosome 2R, r... 38 7.8
26gb|AE003810.3| Drosophila melanogaster chromosome 2R, section 40... 38 7.8
27emb|AL117693.5|CNS01DRO Human chromosome 14 DNA sequence BAC R-5... 38 7.8
28dbj|AP006297.1| Homo sapiens genomic DNA, chromosome 6 clone:RP1... 38 7.8
29gb|AC164092.3| Mus musculus BAC clone RP23-366E4 from chromosome... 38 7.8
30dbj|AP002530.2| Homo sapiens genomic DNA, chromosome 6q21, anti-... 38 7.8
31dbj|AB041340.1| Homo sapiens genomic DNA, chromosome 6q21, clone... 38 7.8

>gb|DQ351213.1| Hordeum vulgare subsp. vulgare resistance protein (ABC1037) gene,
             complete cds
          Length = 25080

 Score =  153 bits (77), Expect = 2e-34
 Identities = 77/77 (100%)
 Strand = Plus / Minus

                                                                         
Query: 85    tggtagaggctagggttctaccaggtctcggacgtaggttgtaggggtggaagtgcgggc 144
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 18982 tggtagaggctagggttctaccaggtctcggacgtaggttgtaggggtggaagtgcgggc 18923

                              
Query: 145   tgcgaggttggggacgc 161
             |||||||||||||||||
Sbjct: 18922 tgcgaggttggggacgc 18906



to top

>ref|XM_587647.2| PREDICTED: Bos taurus similar to GRIP and coiled-coil
           domain-containing 2 isoform a (LOC539484), partial mRNA
          Length = 5264

 Score = 42.1 bits (21), Expect = 0.50
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 128 ggggtggaagtgcgggctgcg 148
           |||||||||||||||||||||
Sbjct: 182 ggggtggaagtgcgggctgcg 202



to top

>ref|XM_647304.1| Entamoeba histolytica HM-1:IMSS predicted protein (119.t00029)
           partial mRNA
          Length = 924

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 26  ctcctttcgatttatcaagt 45
           ||||||||||||||||||||
Sbjct: 545 ctcctttcgatttatcaagt 564



to top

>gb|AC007419.7| Drosophila melanogaster, chromosome 2L, region 25E-25F, BAC clone
              BACR07G15, complete sequence
          Length = 190668

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 30     tttcgatttatcaagtttgacaac 53
              ||||||||||| ||||||||||||
Sbjct: 104139 tttcgatttataaagtttgacaac 104162



to top

>gb|AE003611.3| Drosophila melanogaster chromosome 2L, section 20 of 83 of the complete
             sequence
          Length = 260731

 Score = 40.1 bits (20), Expect = 2.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 30    tttcgatttatcaagtttgacaac 53
             ||||||||||| ||||||||||||
Sbjct: 56845 tttcgatttataaagtttgacaac 56822



to top

>gb|AC153801.1| Mus musculus 10 NOVECTOR RP24-255E19 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 156755

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 71   aaacagtgtctggatggta 89
            |||||||||||||||||||
Sbjct: 3500 aaacagtgtctggatggta 3518



to top

>ref|NM_175768.1| Homo sapiens glutamate receptor, ionotropic, kainate 2 (GRIK2),
            transcript variant 2, mRNA
          Length = 3409

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 71   aaacagtgtctggatggta 89
            |||||||||||||||||||
Sbjct: 2808 aaacagtgtctggatggta 2790



to top

>gb|AC124985.16| Mus musculus chromosome 8, clone RP24-230O22, complete sequence
          Length = 171213

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 118    gtaggttgtaggggtggaagtgc 140
              |||||||||||||||| ||||||
Sbjct: 130223 gtaggttgtaggggtgaaagtgc 130245



to top

>ref|XM_583040.2| PREDICTED: Bos taurus similar to leucine-rich repeats and
            immunoglobulin-like domains 3 (LOC506574), mRNA
          Length = 4308

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 122  gttgtaggggtggaagtgc 140
            |||||||||||||||||||
Sbjct: 1048 gttgtaggggtggaagtgc 1030



to top

>ref|NM_010349.1| Mus musculus glutamate receptor, ionotropic, kainate 2 (beta 2)
            (Grik2), mRNA
          Length = 3109

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 71   aaacagtgtctggatggta 89
            |||||||||||||||||||
Sbjct: 2758 aaacagtgtctggatggta 2740



to top

>gb|AC158556.9| Mus musculus chromosome 15, clone RP23-140F20, complete sequence
          Length = 203053

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 89     agaggctagggttctacca 107
              |||||||||||||||||||
Sbjct: 199009 agaggctagggttctacca 199027



to top

>gb|AC113305.7| Mus musculus chromosome 10, clone RP23-433H22, complete sequence
          Length = 203296

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 71   aaacagtgtctggatggta 89
            |||||||||||||||||||
Sbjct: 2639 aaacagtgtctggatggta 2621



to top

>gb|AC127356.4| Mus musculus BAC clone RP23-100B5 from chromosome 8, complete sequence
          Length = 199258

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 118    gtaggttgtaggggtggaagtgc 140
              |||||||||||||||| ||||||
Sbjct: 194110 gtaggttgtaggggtgaaagtgc 194088



to top

>gb|AC004519.1| Homo sapiens BAC clone CTB-41H4 from 7, complete sequence
          Length = 107889

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 67    tgcaaaacagtgtctggat 85
             |||||||||||||||||||
Sbjct: 66102 tgcaaaacagtgtctggat 66084



to top

>emb|AL355490.24| Human DNA sequence from clone RP11-452K12 on chromosome 10 Contains the
             FRAT1 gene for frequently rearranged in advanced T-cell
             lymphomas, the FRAT2 gene  for frequently rearranged in
             advanced T-cell lymphomas 2, two novel genes, the gene for
             a novel protein (FLJ12434,KIAA0690), the PGAM1 gene for
             phosphoglycerate mutase 1 (brain), the CSL4 gene for
             exosomal core protein CSL4, the ZDHHC16 gene for zinc
             finger, DHHC domain containing 16, the 3' end of the
             MMS19L gene for MMS19-like (MET18 homolog, S. cerevisiae),
             a ribosomal protein L12 (RPL12) pseudogene, a ribosomal
             protein L34 (RPL34) pseudogene and four CpG islands,
             complete sequence
          Length = 190803

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 15    cccaggggaacctcctttc 33
             |||||||||||||||||||
Sbjct: 98227 cccaggggaacctcctttc 98245



to top

>emb|X66117.1|MMGLUR6C M.musculus mRNA for glutamate receptor subunit GluR6-2
          Length = 3109

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 71   aaacagtgtctggatggta 89
            |||||||||||||||||||
Sbjct: 2758 aaacagtgtctggatggta 2740



to top

>emb|AL355532.10| Human DNA sequence from clone RP11-487F5 on chromosome 6 Contains the 3'
              part of the GRIK2 (glutamate receptor, ionotropic, kainate
              2) gene, ESTs, STSs and GSSs, complete sequence
          Length = 181302

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 71     aaacagtgtctggatggta 89
              |||||||||||||||||||
Sbjct: 112708 aaacagtgtctggatggta 112690



to top

>emb|AJ301610.1|HSA301610 Homo sapiens mRNA for GluR6 kainate receptor (GRIK2 gene), isoform-b
          Length = 2692

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 71   aaacagtgtctggatggta 89
            |||||||||||||||||||
Sbjct: 2608 aaacagtgtctggatggta 2590



to top

>gb|AC159091.2| Mus musculus chromosome 15, clone RP24-283J18, complete sequence
          Length = 65063

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 89    agaggctagggttctacca 107
             |||||||||||||||||||
Sbjct: 56387 agaggctagggttctacca 56369



to top

>tpg|BK003828.1| TPA: TPA_inf: Drosophila melanogaster HDC06590 (HDC06590) gene,
            complete cds
          Length = 5191

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 127  aggggtggaagtgcgggct 145
            |||||||||||||||||||
Sbjct: 4737 aggggtggaagtgcgggct 4719



to top

>gb|AC097535.3| Homo sapiens BAC clone RP11-802H3 from 4, complete sequence
          Length = 72759

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 23   aacctcctttcgatttatcaagtttga 49
            ||||||||||| ||||| |||||||||
Sbjct: 8425 aacctcctttcaatttaccaagtttga 8451



to top

>gb|AY634681.1| Hordeum vulgare ADP-glucose pyrophosphorylase small subunit gene,
            complete cds, alternatively spliced
          Length = 9669

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                   
Query: 93   gctagggttctaccaggtctcggacgtaggttgtagggg 131
            |||| ||||||||| ||||| || || ||||||||||||
Sbjct: 7890 gctaaggttctaccgggtctagggcggaggttgtagggg 7928



to top

>gb|AF446141.1| Aegilops tauschii LZ-NBS-LRR class RGA, NBS-LRR class RGA, HCBT-like
             putative defense response protein, and putative alliin
             lyase genes, complete cds; and unknown genes
          Length = 106618

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                    
Query: 93    gctagggttctaccaggtctcggacgtaggttgtagggg 131
             ||||||||||| || ||||| || |||||| ||||||||
Sbjct: 96008 gctagggttctgcccggtctaggccgtaggctgtagggg 96046



to top

>dbj|AB083077.1| Oryzias latipes DNA, globin gene cluster region
          Length = 47119

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 64  ttttgcaaaacagtgtctg 82
           |||||||||||||||||||
Sbjct: 637 ttttgcaaaacagtgtctg 619



to top

>gb|AC008369.1|AC008369 Drosophila melanogaster, chromosome 2R, region 52A4-52B4, P1 clones
             BACR48C01 and DS08592, complete sequence
          Length = 192366

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 127   aggggtggaagtgcgggct 145
             |||||||||||||||||||
Sbjct: 95520 aggggtggaagtgcgggct 95502



to top

>gb|AE003810.3| Drosophila melanogaster chromosome 2R, section 40 of 73 of the complete
              sequence
          Length = 271178

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 127    aggggtggaagtgcgggct 145
              |||||||||||||||||||
Sbjct: 172878 aggggtggaagtgcgggct 172860



to top

>emb|AL117693.5|CNS01DRO Human chromosome 14 DNA sequence BAC R-562L8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 179598

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 49    acaacactccaaatctttt 67
             |||||||||||||||||||
Sbjct: 35134 acaacactccaaatctttt 35116



to top

>dbj|AP006297.1| Homo sapiens genomic DNA, chromosome 6 clone:RP11-645B4, complete
             sequence
          Length = 168768

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 71    aaacagtgtctggatggta 89
             |||||||||||||||||||
Sbjct: 46938 aaacagtgtctggatggta 46920



to top

>gb|AC164092.3| Mus musculus BAC clone RP23-366E4 from chromosome 9, complete sequence
          Length = 203636

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 85     tggtagaggctagggttct 103
              |||||||||||||||||||
Sbjct: 118704 tggtagaggctagggttct 118686



to top

>dbj|AP002530.2| Homo sapiens genomic DNA, chromosome 6q21, anti-oncogene region, section
              3/4
          Length = 300000

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 71     aaacagtgtctggatggta 89
              |||||||||||||||||||
Sbjct: 234915 aaacagtgtctggatggta 234897



to top

>dbj|AB041340.1| Homo sapiens genomic DNA, chromosome 6q21, clone:553P24, complete
             sequence
          Length = 128241

 Score = 38.2 bits (19), Expect = 7.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 71    aaacagtgtctggatggta 89
             |||||||||||||||||||
Sbjct: 61904 aaacagtgtctggatggta 61886


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,113,843
Number of Sequences: 3902068
Number of extensions: 1113843
Number of successful extensions: 77841
Number of sequences better than 10.0: 31
Number of HSP's better than 10.0 without gapping: 31
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77798
Number of HSP's gapped (non-prelim): 43
length of query: 161
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 139
effective length of database: 17,147,199,772
effective search space: 2383460768308
effective search space used: 2383460768308
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top