Clone Name | rbastl16f12 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|AC153877.5| Mus musculus 6 BAC RP23-258E21 (Roswell Park Canc... | 42 | 0.64 | 2 | gb|AC154011.3| Mus musculus 6 BAC RP24-261O15 (Roswell Park Canc... | 42 | 0.64 | 3 | gb|AC117792.6| Mus musculus chromosome 8, clone RP24-549A13, com... | 40 | 2.5 | 4 | dbj|AP002799.3| Homo sapiens genomic DNA, chromosome 11q, clone:... | 40 | 2.5 |
---|
>gb|AC153877.5| Mus musculus 6 BAC RP23-258E21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 232977 Score = 42.1 bits (21), Expect = 0.64 Identities = 21/21 (100%) Strand = Plus / Minus Query: 139 tgaaccaccagttttacctgg 159 ||||||||||||||||||||| Sbjct: 15794 tgaaccaccagttttacctgg 15774
>gb|AC154011.3| Mus musculus 6 BAC RP24-261O15 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 146781 Score = 42.1 bits (21), Expect = 0.64 Identities = 21/21 (100%) Strand = Plus / Minus Query: 139 tgaaccaccagttttacctgg 159 ||||||||||||||||||||| Sbjct: 119717 tgaaccaccagttttacctgg 119697
>gb|AC117792.6| Mus musculus chromosome 8, clone RP24-549A13, complete sequence Length = 174210 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 153 tacctgggcagttctaccat 172 |||||||||||||||||||| Sbjct: 100742 tacctgggcagttctaccat 100761
>dbj|AP002799.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-806N19, complete sequence Length = 177564 Score = 40.1 bits (20), Expect = 2.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 12 cctttgaattgtctttgggg 31 |||||||||||||||||||| Sbjct: 88293 cctttgaattgtctttgggg 88312 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,632,427 Number of Sequences: 3902068 Number of extensions: 1632427 Number of successful extensions: 105724 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 105720 Number of HSP's gapped (non-prelim): 4 length of query: 202 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 180 effective length of database: 17,147,199,772 effective search space: 3086495958960 effective search space used: 3086495958960 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)