ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl16f05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL391666.5| Human DNA sequence from clone RP13-130D24 on chr... 42 0.85
2dbj|AB168483.1| Macaca fascicularis testis cDNA clone: QtsA-1251... 42 0.85
3gb|AC130103.4| Rattus norvegicus BAC CH230-41L20 (Children's Ho... 42 0.85
4ref|NM_200843.1| Danio rerio zgc:65944 (zgc:65944), mRNA 40 3.4
5gb|BC061953.1| Danio rerio zgc:65944, mRNA (cDNA clone MGC:65944... 40 3.4
6gb|AC133210.3| Mus musculus chromosome UNK clone RP23-27L12, com... 40 3.4
7gb|AC125329.4| Mus musculus BAC clone RP23-198F7 from 10, comple... 40 3.4
8gb|AC158143.6| Mus musculus chromosome 5, clone RP23-409I5, comp... 40 3.4
9ref|XM_690673.1| PREDICTED: Danio rerio similar to RAB guanine n... 40 3.4
10emb|BX548241.6| Zebrafish DNA sequence from clone DKEY-23F5 in l... 40 3.4
11gb|AC122360.4| Mus musculus BAC clone RP23-428P21 from chromosom... 40 3.4
12gb|AF098333.1|AF098333 Aenetus virescens cytochrome oxidase subu... 40 3.4
13emb|AL824703.12| Mouse DNA sequence from clone RP23-317M2 on chr... 40 3.4
14emb|AJ009905.1|CCO9905 Coturnix coturnix neuroretina-specific pa... 40 3.4
15emb|AL935293.11| Zebrafish DNA sequence from clone CH211-251D10 ... 40 3.4
16emb|AL583884.20| Mouse DNA sequence from clone RP23-324B16 on ch... 40 3.4

>emb|AL391666.5| Human DNA sequence from clone RP13-130D24 on chromosome Xq21.31-22.1
            Contains a karyopherin (importin) beta 1 (KPNB1)
            pseudogene, complete sequence
          Length = 147080

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 25   agtttgttccatcttttctca 45
            |||||||||||||||||||||
Sbjct: 4897 agtttgttccatcttttctca 4877



to top

>dbj|AB168483.1| Macaca fascicularis testis cDNA clone: QtsA-12511, similar to human
           outer dense fiber of sperm tails 1 (ODF1), mRNA, RefSeq:
           NM_024410.2
          Length = 1584

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 160 aacccaacagttcccatcatg 180
           |||||||||||||||||||||
Sbjct: 605 aacccaacagttcccatcatg 585



to top

>gb|AC130103.4| Rattus norvegicus  BAC CH230-41L20 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 224716

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 141   aaaatttatttacattacaaa 161
             |||||||||||||||||||||
Sbjct: 73057 aaaatttatttacattacaaa 73077



to top

>ref|NM_200843.1| Danio rerio zgc:65944 (zgc:65944), mRNA
          Length = 3274

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 201  tatatcgtactgaaggcaaa 220
            ||||||||||||||||||||
Sbjct: 1015 tatatcgtactgaaggcaaa 1034



to top

>gb|BC061953.1| Danio rerio zgc:65944, mRNA (cDNA clone MGC:65944 IMAGE:6790875),
            complete cds
          Length = 3274

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 201  tatatcgtactgaaggcaaa 220
            ||||||||||||||||||||
Sbjct: 1015 tatatcgtactgaaggcaaa 1034



to top

>gb|AC133210.3| Mus musculus chromosome UNK clone RP23-27L12, complete sequence
          Length = 210702

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 141   aaaatttatttacattacaa 160
             ||||||||||||||||||||
Sbjct: 84673 aaaatttatttacattacaa 84692



to top

>gb|AC125329.4| Mus musculus BAC clone RP23-198F7 from 10, complete sequence
          Length = 211931

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 227   ctgatgactcctgccaagga 246
             ||||||||||||||||||||
Sbjct: 25703 ctgatgactcctgccaagga 25684



to top

>gb|AC158143.6| Mus musculus chromosome 5, clone RP23-409I5, complete sequence
          Length = 191873

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 159   aaacccaacagttcccatca 178
             ||||||||||||||||||||
Sbjct: 94477 aaacccaacagttcccatca 94496



to top

>ref|XM_690673.1| PREDICTED: Danio rerio similar to RAB guanine nucleotide exchange
            factor (GEF) 1 (LOC567380), mRNA
          Length = 2430

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 201  tatatcgtactgaaggcaaa 220
            ||||||||||||||||||||
Sbjct: 1021 tatatcgtactgaaggcaaa 1040



to top

>emb|BX548241.6| Zebrafish DNA sequence from clone DKEY-23F5 in linkage group 10,
            complete sequence
          Length = 92780

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 201  tatatcgtactgaaggcaaa 220
            ||||||||||||||||||||
Sbjct: 1738 tatatcgtactgaaggcaaa 1757



to top

>gb|AC122360.4| Mus musculus BAC clone RP23-428P21 from chromosome 10, complete
             sequence
          Length = 210757

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 227   ctgatgactcctgccaagga 246
             ||||||||||||||||||||
Sbjct: 39672 ctgatgactcctgccaagga 39691



to top

>gb|AF098333.1|AF098333 Aenetus virescens cytochrome oxidase subunit I and cytochrome
           oxidase subunit II genes, partial cds; mitochondrial
           genes for mitochondrial products
          Length = 527

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 142 aaatttatttacattacaaa 161
           ||||||||||||||||||||
Sbjct: 81  aaatttatttacattacaaa 100



to top

>emb|AL824703.12| Mouse DNA sequence from clone RP23-317M2 on chromosome 4, complete
             sequence
          Length = 80922

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   aaatttatttacattacaaa 161
             ||||||||||||||||||||
Sbjct: 77307 aaatttatttacattacaaa 77288



to top

>emb|AJ009905.1|CCO9905 Coturnix coturnix neuroretina-specific pax6 gene enhancer region
          Length = 277

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 150 ttacattacaaacccaacag 169
           ||||||||||||||||||||
Sbjct: 51  ttacattacaaacccaacag 32



to top

>emb|AL935293.11| Zebrafish DNA sequence from clone CH211-251D10 in linkage group 10,
             complete sequence
          Length = 188908

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 201   tatatcgtactgaaggcaaa 220
             ||||||||||||||||||||
Sbjct: 72174 tatatcgtactgaaggcaaa 72193



to top

>emb|AL583884.20| Mouse DNA sequence from clone RP23-324B16 on chromosome 15, complete
              sequence
          Length = 202342

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 144    atttatttacattacaaacc 163
              ||||||||||||||||||||
Sbjct: 175264 atttatttacattacaaacc 175245


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,585,054
Number of Sequences: 3902068
Number of extensions: 2585054
Number of successful extensions: 63513
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63488
Number of HSP's gapped (non-prelim): 25
length of query: 259
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 237
effective length of database: 17,147,199,772
effective search space: 4063886345964
effective search space used: 4063886345964
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top