ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl16e10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC122717.2| Homo sapiens chromosome 5 clone RP11-60H3, comple... 42 1.1
2gb|AC159333.7| Mus musculus 10 BAC RP23-409C14 (Roswell Park Can... 42 1.1
3ref|XM_223830.3| PREDICTED: Rattus norvegicus similar to hypothe... 42 1.1
4ref|XM_323961.1| Neurospora crassa OR74A hypothetical protein (N... 40 4.4
5ref|XM_953756.1| Neurospora crassa OR74A hypothetical protein (N... 40 4.4
6emb|BX294012.1|NC80A10 Neurospora crassa DNA linkage group V Cos... 40 4.4
7gb|AC015684.11| Homo sapiens chromosome 11, clone RP11-2C23, com... 40 4.4
8ref|NM_024381.1| Rattus norvegicus glycerol kinase (Gyk), mRNA 40 4.4
9ref|XM_579490.1| PREDICTED: Rattus norvegicus hypothetical gene ... 40 4.4
10gb|AY135690.1| Mus musculus argonaute 4 protein (Ago4) gene, com... 40 4.4
11emb|Y09448.1|PV09448 P.vulgaris immature mRNA for cinnamate 4-hy... 40 4.4
12emb|Y09447.1|PV09447 P.vulgaris mRNA for cinnamate 4-hydroxylase 40 4.4
13emb|AL606935.8| Mouse DNA sequence from clone RP23-204N19 on chr... 40 4.4
14dbj|D16102.1|RATASTP Rattus norvegicus mRNA for ATP-stimulated g... 40 4.4

>gb|AC122717.2| Homo sapiens chromosome 5 clone RP11-60H3, complete sequence
          Length = 120125

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 87    caacatcaaagctatttgaaa 107
             |||||||||||||||||||||
Sbjct: 25953 caacatcaaagctatttgaaa 25973



to top

>gb|AC159333.7| Mus musculus 10 BAC RP23-409C14 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 201801

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 6     aaatccagttttctccacata 26
             |||||||||||||||||||||
Sbjct: 97707 aaatccagttttctccacata 97687



to top

>ref|XM_223830.3| PREDICTED: Rattus norvegicus similar to hypothetical protein
           FLJ23834 (LOC289926), mRNA
          Length = 2331

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 5   caaatccagttttctccacat 25
           |||||||||||||||||||||
Sbjct: 898 caaatccagttttctccacat 878



to top

>ref|XM_323961.1| Neurospora crassa OR74A hypothetical protein (NCU04606.1) partial
            mRNA
          Length = 2754

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 273  tcatcatccagagtttgggc 292
            ||||||||||||||||||||
Sbjct: 2077 tcatcatccagagtttgggc 2058



to top

>ref|XM_953756.1| Neurospora crassa OR74A hypothetical protein (NCU04606.1) partial
            mRNA
          Length = 2754

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 273  tcatcatccagagtttgggc 292
            ||||||||||||||||||||
Sbjct: 2077 tcatcatccagagtttgggc 2058



to top

>emb|BX294012.1|NC80A10 Neurospora crassa DNA linkage group V Cosmid contig 80A10
          Length = 161126

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 273    tcatcatccagagtttgggc 292
              ||||||||||||||||||||
Sbjct: 150581 tcatcatccagagtttgggc 150600



to top

>gb|AC015684.11| Homo sapiens chromosome 11, clone RP11-2C23, complete sequence
          Length = 183939

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 64     taatggaacttagcttcagt 83
              ||||||||||||||||||||
Sbjct: 136556 taatggaacttagcttcagt 136575



to top

>ref|NM_024381.1| Rattus norvegicus glycerol kinase (Gyk), mRNA
          Length = 2989

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  tttccaacatcaaagctatt 102
           ||||||||||||||||||||
Sbjct: 344 tttccaacatcaaagctatt 363



to top

>ref|XM_579490.1| PREDICTED: Rattus norvegicus hypothetical gene supported by
           NM_024381 (LOC497845), mRNA
          Length = 2985

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  tttccaacatcaaagctatt 102
           ||||||||||||||||||||
Sbjct: 341 tttccaacatcaaagctatt 360



to top

>gb|AY135690.1| Mus musculus argonaute 4 protein (Ago4) gene, complete cds
          Length = 92047

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    tttctccacatacacaaaaa 34
             ||||||||||||||||||||
Sbjct: 52373 tttctccacatacacaaaaa 52354



to top

>emb|Y09448.1|PV09448 P.vulgaris immature mRNA for cinnamate 4-hydroxylase, partial
          Length = 2280

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 20 ccacatacacaaaaatgagt 39
          ||||||||||||||||||||
Sbjct: 1  ccacatacacaaaaatgagt 20



to top

>emb|Y09447.1|PV09447 P.vulgaris mRNA for cinnamate 4-hydroxylase
          Length = 1799

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 20 ccacatacacaaaaatgagt 39
          ||||||||||||||||||||
Sbjct: 1  ccacatacacaaaaatgagt 20



to top

>emb|AL606935.8| Mouse DNA sequence from clone RP23-204N19 on chromosome 4, complete
             sequence
          Length = 213391

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    tttctccacatacacaaaaa 34
             ||||||||||||||||||||
Sbjct: 65792 tttctccacatacacaaaaa 65811



to top

>dbj|D16102.1|RATASTP Rattus norvegicus mRNA for ATP-stimulated glucocorticoid-receptor
           translocaton promoter, complete cds
          Length = 2989

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 83  tttccaacatcaaagctatt 102
           ||||||||||||||||||||
Sbjct: 344 tttccaacatcaaagctatt 363


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,611,689
Number of Sequences: 3902068
Number of extensions: 3611689
Number of successful extensions: 69853
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69835
Number of HSP's gapped (non-prelim): 18
length of query: 336
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 314
effective length of database: 17,147,199,772
effective search space: 5384220728408
effective search space used: 5384220728408
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top