>gb|AC158581.2| Mus musculus chromosome 3, clone RP24-264G1, complete sequence
          Length = 166808

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 232    tgctgagacatccatcatcca 252
              |||||||||||||||||||||
Sbjct: 107588 tgctgagacatccatcatcca 107608

>gb|AC102278.10| Mus musculus chromosome 3, clone RP24-298A6, complete sequence
          Length = 184908

 Score = 42.1 bits (21), Expect = 0.86
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 232   tgctgagacatccatcatcca 252
             |||||||||||||||||||||
Sbjct: 11976 tgctgagacatccatcatcca 11956

>gb|BC092191.1| Rattus norvegicus cDNA clone IMAGE:7111416, **** WARNING: chimeric
            clone ****
          Length = 4570

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 56   ttcgttcctcacctccagctccat 79
            |||||||||| |||||||||||||
Sbjct: 3089 ttcgttcctctcctccagctccat 3112

>emb|BX927372.14| Zebrafish DNA sequence from clone CH211-241H14 in linkage group 13,
             complete sequence
          Length = 138336

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 161   accaaacacaatgaatcagatcac 184
             ||||||||||||||| ||||||||
Sbjct: 18801 accaaacacaatgaaccagatcac 18778

>emb|AL954847.17| Zebrafish DNA sequence from clone DKEY-68G8 in linkage group 13, complete
              sequence
          Length = 278040

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 161    accaaacacaatgaatcagatcac 184
              ||||||||||||||| ||||||||
Sbjct: 242072 accaaacacaatgaaccagatcac 242049

>gb|AC147839.2| Xenopus tropicalis clone CH216-9N23, complete sequence
          Length = 184473

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 137    catggaaccatccaaaccca 156
              ||||||||||||||||||||
Sbjct: 152795 catggaaccatccaaaccca 152814

>gb|BC087131.1| Rattus norvegicus glutamate-ammonia ligase (glutamine synthase), mRNA
            (cDNA clone MGC:94942 IMAGE:7112880), complete cds
          Length = 4157

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 56   ttcgttcctcacctccagctccat 79
            |||||||||| |||||||||||||
Sbjct: 2805 ttcgttcctctcctccagctccat 2782

>ref|NM_017073.2| Rattus norvegicus glutamate-ammonia ligase (glutamine synthase)
            (Glul), mRNA
          Length = 4157

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 56   ttcgttcctcacctccagctccat 79
            |||||||||| |||||||||||||
Sbjct: 2805 ttcgttcctctcctccagctccat 2782

>emb|X92074.1|RNGLUSYNI R.norvegicus glutamine synthetase intron 1
          Length = 1938

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 56   ttcgttcctcacctccagctccat 79
            |||||||||| |||||||||||||
Sbjct: 1013 ttcgttcctctcctccagctccat 990


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,263,585
Number of Sequences: 3902068
Number of extensions: 2263585
Number of successful extensions: 53693
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53680
Number of HSP's gapped (non-prelim): 13
length of query: 261
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 239
effective length of database: 17,147,199,772
effective search space: 4098180745508
effective search space used: 4098180745508
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)