>gb|AC102655.7| Mus musculus chromosome 19, clone RP23-13N2, complete sequence
          Length = 202294

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 70    aataaaaatgtttttggatgaa 91
             ||||||||||||||||||||||
Sbjct: 56757 aataaaaatgtttttggatgaa 56736

>ref|NM_105369.1| Arabidopsis thaliana glycerophosphodiester phosphodiesterase/ kinase
            AT1G66980 mRNA, complete cds
          Length = 3512

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 72   taaaaatgtttttggatgaa 91
            ||||||||||||||||||||
Sbjct: 3459 taaaaatgtttttggatgaa 3440

>gb|AC007152.9| Arabidopsis thaliana chromosome I BAC F1O19 genomic sequence, complete
             sequence
          Length = 90387

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    taaaaatgtttttggatgaa 91
             ||||||||||||||||||||
Sbjct: 27065 taaaaatgtttttggatgaa 27084

>emb|BX294171.10| Zebrafish DNA sequence from clone DKEY-263M10 in linkage group 1,
             complete sequence
          Length = 121187

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   ctccaaaaacttgcatcaga 197
             ||||||||||||||||||||
Sbjct: 30564 ctccaaaaacttgcatcaga 30545

>gb|AC090943.3| Homo sapiens chromosome 3 clone RP11-22O15 map 3p, complete sequence
          Length = 162949

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 102    atgccgaggtgtaagagcat 121
              ||||||||||||||||||||
Sbjct: 107859 atgccgaggtgtaagagcat 107878

>gb|AC091291.2| Homo sapiens chromosome 3 clone RP11-654A18 map 3p, complete sequence
          Length = 184579

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   atgccgaggtgtaagagcat 121
             ||||||||||||||||||||
Sbjct: 65374 atgccgaggtgtaagagcat 65393

>emb|AL953916.14| Zebrafish DNA sequence from clone CH211-246I7 in linkage group 12,
              complete sequence
          Length = 177468

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 72     taaaaatgtttttggatgaa 91
              ||||||||||||||||||||
Sbjct: 161862 taaaaatgtttttggatgaa 161843

>emb|AL672058.5| Zebrafish DNA sequence from clone BUSM1-47J20 in linkage group 1,
              complete sequence
          Length = 130339

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 178    ctccaaaaacttgcatcaga 197
              ||||||||||||||||||||
Sbjct: 100541 ctccaaaaacttgcatcaga 100560

>gb|AY449460.1| Oikopleura dioica clone BACOIKO004 7xk22, complete sequence
          Length = 131867

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    tttttggatgaaccaccagc 99
             ||||||||||||||||||||
Sbjct: 64488 tttttggatgaaccaccagc 64507

>emb|AL844859.5| Mouse DNA sequence from clone RP23-263O20 on chromosome 2, complete
             sequence
          Length = 151493

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    aataaaaatgtttttggatg 89
             ||||||||||||||||||||
Sbjct: 61609 aataaaaatgtttttggatg 61590


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,995,373
Number of Sequences: 3902068
Number of extensions: 1995373
Number of successful extensions: 134315
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 134287
Number of HSP's gapped (non-prelim): 28
length of query: 223
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 201
effective length of database: 17,147,199,772
effective search space: 3446587154172
effective search space used: 3446587154172
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)