ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl16a10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC022022.10| Homo sapiens chromosome 10 clone RP11-351O1, com... 46 0.090
2gb|AC117251.3| Mus musculus BAC clone RP24-372C12 from chromosom... 44 0.36
3gb|AC102333.10| Mus musculus chromosome 18, clone RP24-542P12, c... 42 1.4
4gb|AC161175.5| Mus musculus chromosome 18, clone RP23-2J13, comp... 42 1.4
5gb|AF369352.1|AF369352 Rabies virus 7890.LBB phosphoprotein (P) ... 42 1.4
6gb|AF369291.1|AF369291 Rabies virus V216.SK phosphoprotein (P) g... 42 1.4
7gb|AF369290.1|AF369290 Rabies virus V215.SK phosphoprotein (P) g... 42 1.4
8gb|AC010708.10|AC010708 Drosophila melanogaster, chromosome X, r... 42 1.4
9gb|AC012098.9|AC012098 Drosophila melanogaster, chromosome X, re... 42 1.4
10gb|AE003509.5| Drosophila melanogaster chromosome X, section 61 ... 42 1.4
11gb|AC150408.2| Branchiostoma floridae clone CH302-56A5, complete... 40 5.5
12gb|AC149488.1| Solanum demissum chromosome 11 clone PGEC542 map ... 40 5.5
13gb|AC102090.14| Mus musculus chromosome 1, clone RP23-7I3, compl... 40 5.5
14gb|AE004303.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 40 5.5
15emb|AL391825.15| Human DNA sequence from clone RP11-456P18 on ch... 40 5.5
16gb|AC073065.6| Homo sapiens BAC clone RP11-149O3 from 2, complet... 40 5.5
17emb|BX005208.11| Mouse DNA sequence from clone RP23-281F18 on ch... 40 5.5

>gb|AC022022.10| Homo sapiens chromosome 10 clone RP11-351O1, complete sequence
          Length = 183604

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 240   acaagaatgctacaacaacaaca 262
             |||||||||||||||||||||||
Sbjct: 38717 acaagaatgctacaacaacaaca 38739



to top

>gb|AC117251.3| Mus musculus BAC clone RP24-372C12 from chromosome 8, complete sequence
          Length = 191927

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 250   tacaacaacaacatagcttatg 271
             ||||||||||||||||||||||
Sbjct: 37364 tacaacaacaacatagcttatg 37385



to top

>gb|AC102333.10| Mus musculus chromosome 18, clone RP24-542P12, complete sequence
          Length = 188821

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 30     tcaatcaaagatgaacaagaa 50
              |||||||||||||||||||||
Sbjct: 138430 tcaatcaaagatgaacaagaa 138410



to top

>gb|AC161175.5| Mus musculus chromosome 18, clone RP23-2J13, complete sequence
          Length = 225231

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 30     tcaatcaaagatgaacaagaa 50
              |||||||||||||||||||||
Sbjct: 103100 tcaatcaaagatgaacaagaa 103080



to top

>gb|AF369352.1|AF369352 Rabies virus 7890.LBB phosphoprotein (P) gene, complete cds
          Length = 920

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 181 catccaaagccaaaatggcgg 201
           |||||||||||||||||||||
Sbjct: 503 catccaaagccaaaatggcgg 523



to top

>gb|AF369291.1|AF369291 Rabies virus V216.SK phosphoprotein (P) gene, complete cds
          Length = 920

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 181 catccaaagccaaaatggcgg 201
           |||||||||||||||||||||
Sbjct: 503 catccaaagccaaaatggcgg 523



to top

>gb|AF369290.1|AF369290 Rabies virus V215.SK phosphoprotein (P) gene, complete cds
          Length = 920

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 181 catccaaagccaaaatggcgg 201
           |||||||||||||||||||||
Sbjct: 503 catccaaagccaaaatggcgg 523



to top

>gb|AC010708.10|AC010708 Drosophila melanogaster, chromosome X, region 17A-17B, BAC clone
              BACR10E05, complete sequence
          Length = 188766

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 51     aaccgaaccatcgaaccatcg 71
              |||||||||||||||||||||
Sbjct: 160719 aaccgaaccatcgaaccatcg 160739



to top

>gb|AC012098.9|AC012098 Drosophila melanogaster, chromosome X, region 17A-17B, BAC clone
             BACR03K10, complete sequence
          Length = 188489

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 51    aaccgaaccatcgaaccatcg 71
             |||||||||||||||||||||
Sbjct: 76096 aaccgaaccatcgaaccatcg 76116



to top

>gb|AE003509.5| Drosophila melanogaster chromosome X, section 61 of 74 of the
           complete sequence
          Length = 315109

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 51  aaccgaaccatcgaaccatcg 71
           |||||||||||||||||||||
Sbjct: 108 aaccgaaccatcgaaccatcg 128



to top

>gb|AC150408.2| Branchiostoma floridae clone CH302-56A5, complete sequence
          Length = 180427

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 245   aatgctacaacaacaacata 264
             ||||||||||||||||||||
Sbjct: 91425 aatgctacaacaacaacata 91444



to top

>gb|AC149488.1| Solanum demissum chromosome 11 clone PGEC542 map MAP_LOC, complete
             sequence
          Length = 117252

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 245   aatgctacaacaacaacata 264
             ||||||||||||||||||||
Sbjct: 52656 aatgctacaacaacaacata 52637



to top

>gb|AC102090.14| Mus musculus chromosome 1, clone RP23-7I3, complete sequence
          Length = 183269

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 248   gctacaacaacaacatagct 267
             ||||||||||||||||||||
Sbjct: 56159 gctacaacaacaacatagct 56140



to top

>gb|AE004303.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 211
            of 251 of the complete chromosome
          Length = 13625

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 177  atcacatccaaagccaaaat 196
            ||||||||||||||||||||
Sbjct: 3476 atcacatccaaagccaaaat 3495



to top

>emb|AL391825.15| Human DNA sequence from clone RP11-456P18 on chromosome 1 Contains the 3'
              end of the ATF6 gene for activating transcription factor 6,
              a  proteasome (prosome, macropain) activator subunit 1
              (PA28 alpha)(PSME1) pseudogene, the 3' end of a novel gene
              (DKFZP586L151) and a CpG island, complete sequence
          Length = 211662

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 32     aatcaaagatgaacaagaaa 51
              ||||||||||||||||||||
Sbjct: 206613 aatcaaagatgaacaagaaa 206594



to top

>gb|AC073065.6| Homo sapiens BAC clone RP11-149O3 from 2, complete sequence
          Length = 175345

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    atcaaagatgaacaagaaaa 52
             ||||||||||||||||||||
Sbjct: 36058 atcaaagatgaacaagaaaa 36039



to top

>emb|BX005208.11| Mouse DNA sequence from clone RP23-281F18 on chromosome 1, complete
            sequence
          Length = 101200

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 248  gctacaacaacaacatagct 267
            ||||||||||||||||||||
Sbjct: 4350 gctacaacaacaacatagct 4331


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,600,531
Number of Sequences: 3902068
Number of extensions: 3600531
Number of successful extensions: 55768
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55734
Number of HSP's gapped (non-prelim): 34
length of query: 414
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 392
effective length of database: 17,147,199,772
effective search space: 6721702310624
effective search space used: 6721702310624
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top