ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl15h12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BT009144.1| Triticum aestivum clone wl1n.pk0054.d8:fis, full ... 50 0.002
2gb|AC068600.5| Homo sapiens BAC clone RP11-567N20 from 2, comple... 42 0.55
3gb|AC154807.2| Mus musculus BAC clone RP23-79E7 from chromosome ... 42 0.55
4gb|AC133907.9| Mus musculus chromosome 1, clone RP24-239K20, com... 40 2.2
5gb|AE013117.1| Thermoanaerobacter tengcongensis MB4, section 144... 40 2.2
6gb|AC009108.10| Homo sapiens chromosome 16 clone RP11-463O9, com... 40 2.2
7emb|AL356102.13| Human DNA sequence from clone RP11-490P13 on ch... 40 2.2
8gb|AC140778.15| Mus musculus chromosome 1, clone RP24-446J17, co... 40 2.2
9dbj|AK091834.1| Homo sapiens cDNA FLJ34515 fis, clone HLUNG2006614 40 2.2
10gb|AC024591.4| Homo sapiens chromosome 16 clone RP11-511G21, com... 40 2.2
11gb|AC021887.4|AC021887 Homo sapiens BAC clone RP11-777M17 from 1... 40 2.2
12emb|BX324191.9| Mouse DNA sequence from clone RP23-457L22 on chr... 40 2.2
13emb|AL808116.6| Mouse DNA sequence from clone RP23-97H1 on chrom... 40 2.2
14gb|AC125792.2| Homo sapiens chromosome 16 clone CTD-3032L3, comp... 40 2.2
15gb|AC152978.1| Mus musculus BAC RP23-111A15 (Roswell Park Cance... 38 8.6
16gb|AC123743.11| Mus musculus chromosome 5, clone RP24-116M4, com... 38 8.6
17ref|XM_520054.1| PREDICTED: Pan troglodytes similar to ADP-ribos... 38 8.6
18gb|AC150551.1| Drosophila melanogaster clone BACR16A12, complete... 38 8.6
19gb|BC022866.1| Homo sapiens ADP-ribosylation factor 4, mRNA (cDN... 38 8.6
20gb|BC016325.1| Homo sapiens ADP-ribosylation factor 4, mRNA (cDN... 38 8.6
21gb|BC003364.1| Homo sapiens ADP-ribosylation factor 4, mRNA (cDN... 38 8.6
22ref|NM_007479.2| Mus musculus ADP-ribosylation factor 4 (Arf4), ... 38 8.6
23gb|AC140291.2| Mus musculus BAC clone RP24-326N12 from chromosom... 38 8.6
24gb|AY915859.1| Schistosoma japonicum SJCHGC09793 protein mRNA, c... 38 8.6
25gb|AC125126.4| Mus musculus BAC clone RP24-282D2 from chromosome... 38 8.6
26gb|AC121919.3| Mus musculus BAC clone RP24-195I15 from chromosom... 38 8.6
27gb|AC127331.4| Mus musculus BAC clone RP23-127A19 from 18, compl... 38 8.6
28gb|AC122912.2| Mus musculus BAC clone RP23-61E5 from 7, complete... 38 8.6
29gb|AC116320.5| Mus musculus chromosome 18 clone RP23-269B16, com... 38 8.6
30gb|AC098654.2| Homo sapiens chromosome 1 clone RP11-475O6, compl... 38 8.6
31emb|AL008639.15|HS9E21 Human DNA sequence from clone RP1-9E21 on... 38 8.6
32emb|AJ421478.1| Mus musculus X-inactivation center region; segme... 38 8.6
33emb|CR858319.1| Pongo pygmaeus mRNA; cDNA DKFZp468F2120 (from cl... 38 8.6
34emb|CR615713.1| full-length cDNA clone CS0DI042YL07 of Placenta ... 38 8.6
35emb|CR625897.1| full-length cDNA clone CS0DK004YE24 of HeLa cell... 38 8.6
36emb|CR625816.1| full-length cDNA clone CS0DA002YE02 of Neuroblas... 38 8.6
37emb|CR622582.1| full-length cDNA clone CS0DE001YD02 of Placenta ... 38 8.6
38emb|CR618819.1| full-length cDNA clone CS0DI060YI19 of Placenta ... 38 8.6
39gb|AC135610.5| Pan troglodytes clone rp43-11n14, complete sequence 38 8.6
40emb|CR611234.1| full-length cDNA clone CS0DI084YD14 of Placenta ... 38 8.6
41emb|CR611196.1| full-length cDNA clone CS0DI016YN12 of Placenta ... 38 8.6
42emb|CR607867.1| full-length cDNA clone CS0DI017YH05 of Placenta ... 38 8.6
43emb|CR607207.1| full-length cDNA clone CS0DE004YP13 of Placenta ... 38 8.6
44emb|CR597516.1| full-length cDNA clone CS0DA006YA23 of Neuroblas... 38 8.6
45emb|CR596585.1| full-length cDNA clone CS0DI059YI11 of Placenta ... 38 8.6
46emb|CR595935.1| full-length cDNA clone CS0DF013YG10 of Fetal bra... 38 8.6
47emb|CR592933.1| full-length cDNA clone CS0DF001YG24 of Fetal bra... 38 8.6
48emb|CR591617.1| full-length cDNA clone CS0DK007YG21 of HeLa cell... 38 8.6
49emb|CR591127.1| full-length cDNA clone CS0DF017YF17 of Fetal bra... 38 8.6
50gb|AC115482.2| Drosophila melanogaster, chromosome 2L, region 21... 38 8.6
51ref|NM_001660.2| Homo sapiens ADP-ribosylation factor 4 (ARF4), ... 38 8.6
52dbj|AK153011.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 38 8.6
53dbj|AK168793.1| Mus musculus 17 days embryo heart cDNA, RIKEN fu... 38 8.6
54dbj|AK013892.1| Mus musculus 12 days embryo head cDNA, RIKEN ful... 38 8.6
55dbj|AK081686.1| Mus musculus 16 days embryo head cDNA, RIKEN ful... 38 8.6
56dbj|AK002302.1| Mus musculus adult male kidney cDNA, RIKEN full-... 38 8.6
57gb|AC007064.27| Homo sapiens Chromosome 22q11 PAC Clone p87o8 in... 38 8.6
58gb|AC006548.22| Homo sapiens chromosome 22 clone p20k14 map 22q1... 38 8.6
59dbj|AK054371.1| Mus musculus 2 days pregnant adult female ovary ... 38 8.6
60gb|AC008002.3|AC008002 Drosophila melanogaster, chromosome 2L, r... 38 8.6
61gb|AC110770.4| Homo sapiens BAC clone RP11-159P15 from 2, comple... 38 8.6
62gb|AC079244.29| Mus musculus strain C57BL/6J chromosome 9 clone ... 38 8.6
63gb|AC114480.2| Homo sapiens chromosome 3 clone RP11-755B10, comp... 38 8.6
64gb|AC092418.3| Homo sapiens chromosome 3 clone RP11-229A12, comp... 38 8.6
65dbj|AK211971.1| Mus musculus cDNA, clone:Y2G0123H07, strand:minu... 38 8.6
66dbj|AK206349.1| Mus musculus cDNA, clone:Y2G0104I24, strand:minu... 38 8.6
67gb|AF104238.1|HSARF4G6 Homo sapiens ADP-ribosylation factor 4 (A... 38 8.6
68gb|AE003589.4| Drosophila melanogaster chromosome 2L, section 2 ... 38 8.6
69gb|AC005269.1|AC005269 Drosophila melanogaster DNA sequence (P1s... 38 8.6
70gb|AC135353.3| Mus musculus BAC clone RP24-401C17 from 9, comple... 38 8.6
71emb|BX005190.8| Mouse DNA sequence from clone RP23-383A22 on chr... 38 8.6
72gb|AC096784.17| Mus musculus strain C57BL/6J chromosome 10 clone... 38 8.6
73gb|AC140407.5| Mus musculus BAC clone RP23-142K9 from chromosome... 38 8.6
74emb|AL928671.6| Zebrafish DNA sequence from clone CH211-39M14, c... 38 8.6
75emb|AL671187.9| Mouse DNA sequence from clone RP23-273N4 on chro... 38 8.6
76gb|M36341.1|HUMARF4 Human ADP-ribosylation factor 4 (ARF4) mRNA,... 38 8.6
77dbj|D87901.1| Mouse mRNA for ARF4, complete cds 38 8.6 
>gb|BT009144.1| Triticum aestivum clone wl1n.pk0054.d8:fis, full insert mRNA
           sequence
          Length = 876

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 136 attagaaattctccttgggaaactcaaactttgtgtt 172
           ||||||| ||||||||| | |||||||||||||||||
Sbjct: 575 attagaagttctccttgtggaactcaaactttgtgtt 539
to top
>gb|AC068600.5| Homo sapiens BAC clone RP11-567N20 from 2, complete sequence
          Length = 136657

 Score = 42.1 bits (21), Expect = 0.55
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 50    cttggattattatttctctac 70
             |||||||||||||||||||||
Sbjct: 56393 cttggattattatttctctac 56413
to top
>gb|AC154807.2| Mus musculus BAC clone RP23-79E7 from chromosome 16, complete sequence
          Length = 256130

 Score = 42.1 bits (21), Expect = 0.55
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 67     ctaccttattatgatgaccca 87
              |||||||||||||||||||||
Sbjct: 182545 ctaccttattatgatgaccca 182525
to top
>gb|AC133907.9| Mus musculus chromosome 1, clone RP24-239K20, complete sequence
          Length = 150662

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 120    tacatacatatgtgtaattagaaattct 147
              ||||||||||||| ||||||| ||||||
Sbjct: 101833 tacatacatatgtataattagtaattct 101806
to top
>gb|AE013117.1| Thermoanaerobacter tengcongensis MB4, section 144 of 244 of the
            complete genome
          Length = 11711

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 58   attatttctctaccttattatgat 81
            ||||||||||| ||||||||||||
Sbjct: 4762 attatttctcttccttattatgat 4739
to top
>gb|AC009108.10| Homo sapiens chromosome 16 clone RP11-463O9, complete sequence
          Length = 168656

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 90     ccataaaagggcaggttctt 109
              ||||||||||||||||||||
Sbjct: 167341 ccataaaagggcaggttctt 167360
to top
>emb|AL356102.13| Human DNA sequence from clone RP11-490P13 on chromosome 13, complete
              sequence
          Length = 139035

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    atatgtgtaattagaaattc 146
              ||||||||||||||||||||
Sbjct: 123831 atatgtgtaattagaaattc 123850
to top
>gb|AC140778.15| Mus musculus chromosome 1, clone RP24-446J17, complete sequence
          Length = 160859

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 120    tacatacatatgtgtaattagaaattct 147
              ||||||||||||| ||||||| ||||||
Sbjct: 148059 tacatacatatgtataattagtaattct 148086
to top
>dbj|AK091834.1| Homo sapiens cDNA FLJ34515 fis, clone HLUNG2006614
          Length = 3093

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 90   ccataaaagggcaggttctt 109
            ||||||||||||||||||||
Sbjct: 1129 ccataaaagggcaggttctt 1148
to top
>gb|AC024591.4| Homo sapiens chromosome 16 clone RP11-511G21, complete sequence
          Length = 104680

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 90    ccataaaagggcaggttctt 109
             ||||||||||||||||||||
Sbjct: 72228 ccataaaagggcaggttctt 72209
to top
>gb|AC021887.4|AC021887 Homo sapiens BAC clone RP11-777M17 from 12, complete sequence
          Length = 194497

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 141   aaattctccttgggaaactc 160
             ||||||||||||||||||||
Sbjct: 32963 aaattctccttgggaaactc 32982
to top
>emb|BX324191.9| Mouse DNA sequence from clone RP23-457L22 on chromosome X, complete
             sequence
          Length = 68456

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 114   tatagctacatacatatgtgtaat 137
             ||||||| ||||||||||||||||
Sbjct: 17218 tatagctgcatacatatgtgtaat 17195
to top
>emb|AL808116.6| Mouse DNA sequence from clone RP23-97H1 on chromosome X, complete
              sequence
          Length = 200519

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 121    acatacatatgtgtaattagaaat 144
              |||||||| |||||||||||||||
Sbjct: 114246 acatacatctgtgtaattagaaat 114269
to top
>gb|AC125792.2| Homo sapiens chromosome 16 clone CTD-3032L3, complete sequence
          Length = 76433

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 90    ccataaaagggcaggttctt 109
             ||||||||||||||||||||
Sbjct: 55339 ccataaaagggcaggttctt 55320
to top
>gb|AC152978.1| Mus musculus  BAC RP23-111A15 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 180393

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 81     tgacccagaccataaaagggcag 103
              |||||||||||| ||||||||||
Sbjct: 139912 tgacccagaccaaaaaagggcag 139934
to top
>gb|AC123743.11| Mus musculus chromosome 5, clone RP24-116M4, complete sequence
          Length = 177350

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 114   tatagctacatacatatgt 132
             |||||||||||||||||||
Sbjct: 10364 tatagctacatacatatgt 10382
to top
>ref|XM_520054.1| PREDICTED: Pan troglodytes similar to ADP-ribosylation factor 4
           (LOC464506), mRNA
          Length = 978

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 928 agaaattctccttgggaaa 946
to top
>gb|AC150551.1| Drosophila melanogaster clone BACR16A12, complete sequence
          Length = 185417

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 115    atagctacatacatatgtg 133
              |||||||||||||||||||
Sbjct: 154368 atagctacatacatatgtg 154350
to top
>gb|BC022866.1| Homo sapiens ADP-ribosylation factor 4, mRNA (cDNA clone MGC:23747
           IMAGE:4105832), complete cds
          Length = 1645

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 961 agaaattctccttgggaaa 979
to top
>gb|BC016325.1| Homo sapiens ADP-ribosylation factor 4, mRNA (cDNA clone MGC:23710
           IMAGE:4093061), complete cds
          Length = 1666

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 981 agaaattctccttgggaaa 999
to top
>gb|BC003364.1| Homo sapiens ADP-ribosylation factor 4, mRNA (cDNA clone MGC:5322
           IMAGE:2900495), complete cds
          Length = 1605

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 928 agaaattctccttgggaaa 946
to top
>ref|NM_007479.2| Mus musculus ADP-ribosylation factor 4 (Arf4), mRNA
          Length = 2042

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 966 agaaattctccttgggaaa 984
to top
>gb|AC140291.2| Mus musculus BAC clone RP24-326N12 from chromosome 5, complete sequence
          Length = 167269

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 114   tatagctacatacatatgt 132
             |||||||||||||||||||
Sbjct: 68607 tatagctacatacatatgt 68589
to top
>gb|AY915859.1| Schistosoma japonicum SJCHGC09793 protein mRNA, complete cds
          Length = 437

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 61  atttctctaccttattatg 79
           |||||||||||||||||||
Sbjct: 203 atttctctaccttattatg 185
to top
>gb|AC125126.4| Mus musculus BAC clone RP24-282D2 from chromosome 7, complete sequence
          Length = 175906

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 120    tacatacatatgtgtaatt 138
              |||||||||||||||||||
Sbjct: 146782 tacatacatatgtgtaatt 146800
to top
>gb|AC121919.3| Mus musculus BAC clone RP24-195I15 from chromosome 14, complete
             sequence
          Length = 146974

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 139   agaaattctccttgggaaa 157
             |||||||||||||||||||
Sbjct: 87589 agaaattctccttgggaaa 87571
to top
>gb|AC127331.4| Mus musculus BAC clone RP23-127A19 from 18, complete sequence
          Length = 179177

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 114   tatagctacatacatatgt 132
             |||||||||||||||||||
Sbjct: 88369 tatagctacatacatatgt 88387
to top
>gb|AC122912.2| Mus musculus BAC clone RP23-61E5 from 7, complete sequence
          Length = 255062

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 120   tacatacatatgtgtaatt 138
             |||||||||||||||||||
Sbjct: 79610 tacatacatatgtgtaatt 79628
to top
>gb|AC116320.5| Mus musculus chromosome 18 clone RP23-269B16, complete sequence
          Length = 195630

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 114    tatagctacatacatatgt 132
              |||||||||||||||||||
Sbjct: 171739 tatagctacatacatatgt 171757
to top
>gb|AC098654.2| Homo sapiens chromosome 1 clone RP11-475O6, complete sequence
          Length = 159975

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 139   agaaattctccttgggaaa 157
             |||||||||||||||||||
Sbjct: 70287 agaaattctccttgggaaa 70269
to top
>emb|AL008639.15|HS9E21 Human DNA sequence from clone RP1-9E21 on chromosome 1q24-25 Contains
             the 3' end of a pseudogene similar to flavin-containing
             monooxygenase proteins, a calponin 2 (CNN2) pseudogene,
             the POGK gene for pogo transposable element with KRAB
             domain, the 3' end of the gene for SPT3-associated factor
             42 (STAF42) and a CpG island, complete sequence
          Length = 106977

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 113   ttatagctacatacatatgtgta 135
             ||||| |||||||||||||||||
Sbjct: 42325 ttatatctacatacatatgtgta 42303
to top
>emb|AJ421478.1| Mus musculus X-inactivation center region; segment 1/3
          Length = 247850

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 62    tttctctaccttattatga 80
             |||||||||||||||||||
Sbjct: 63334 tttctctaccttattatga 63316
to top
>emb|CR858319.1| Pongo pygmaeus mRNA; cDNA DKFZp468F2120 (from clone DKFZp468F2120)
          Length = 1645

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 139  agaaattctccttgggaaa 157
            |||||||||||||||||||
Sbjct: 982  agaaattctccttgggaaa 1000
to top
>emb|CR615713.1| full-length cDNA clone CS0DI042YL07 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1467

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 837 agaaattctccttgggaaa 855
to top
>emb|CR625897.1| full-length cDNA clone CS0DK004YE24 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1583

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 954 agaaattctccttgggaaa 972
to top
>emb|CR625816.1| full-length cDNA clone CS0DA002YE02 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1546

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 961 agaaattctccttgggaaa 979
to top
>emb|CR622582.1| full-length cDNA clone CS0DE001YD02 of Placenta of Homo sapiens
           (human)
          Length = 1561

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 916 agaaattctccttgggaaa 934
to top
>emb|CR618819.1| full-length cDNA clone CS0DI060YI19 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1360

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 736 agaaattctccttgggaaa 754
to top
>gb|AC135610.5| Pan troglodytes clone rp43-11n14, complete sequence
          Length = 154701

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 118   gctacatacatatgtgtaa 136
             |||||||||||||||||||
Sbjct: 65810 gctacatacatatgtgtaa 65828
to top
>emb|CR611234.1| full-length cDNA clone CS0DI084YD14 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1547

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 902 agaaattctccttgggaaa 920
to top
>emb|CR611196.1| full-length cDNA clone CS0DI016YN12 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1540

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 916 agaaattctccttgggaaa 934
to top
>emb|CR607867.1| full-length cDNA clone CS0DI017YH05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1549

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 920 agaaattctccttgggaaa 938
to top
>emb|CR607207.1| full-length cDNA clone CS0DE004YP13 of Placenta of Homo sapiens
           (human)
          Length = 1535

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 916 agaaattctccttgggaaa 934
to top
>emb|CR597516.1| full-length cDNA clone CS0DA006YA23 of Neuroblastoma of Homo
           sapiens (human)
          Length = 1544

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 916 agaaattctccttgggaaa 934
to top
>emb|CR596585.1| full-length cDNA clone CS0DI059YI11 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 1555

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 927 agaaattctccttgggaaa 945
to top
>emb|CR595935.1| full-length cDNA clone CS0DF013YG10 of Fetal brain of Homo sapiens
           (human)
          Length = 1543

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 916 agaaattctccttgggaaa 934
to top
>emb|CR592933.1| full-length cDNA clone CS0DF001YG24 of Fetal brain of Homo sapiens
            (human)
          Length = 1645

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 139  agaaattctccttgggaaa 157
            |||||||||||||||||||
Sbjct: 1001 agaaattctccttgggaaa 1019
to top
>emb|CR591617.1| full-length cDNA clone CS0DK007YG21 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1547

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 902 agaaattctccttgggaaa 920
to top
>emb|CR591127.1| full-length cDNA clone CS0DF017YF17 of Fetal brain of Homo sapiens
            (human)
          Length = 1601

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 139  agaaattctccttgggaaa 157
            |||||||||||||||||||
Sbjct: 984  agaaattctccttgggaaa 1002
to top
>gb|AC115482.2| Drosophila melanogaster, chromosome 2L, region 21D-21D, BAC clone
              BACR04A24, complete sequence
          Length = 166677

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 115    atagctacatacatatgtg 133
              |||||||||||||||||||
Sbjct: 159798 atagctacatacatatgtg 159780
to top
>ref|NM_001660.2| Homo sapiens ADP-ribosylation factor 4 (ARF4), mRNA
          Length = 1610

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 943 agaaattctccttgggaaa 961
to top
>dbj|AK153011.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830114A04
           product:ADP-ribosylation factor 4, full insert sequence
          Length = 1603

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 950 agaaattctccttgggaaa 968
to top
>dbj|AK168793.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched
            library, clone:I920055J03 product:ADP-ribosylation factor
            4, full insert sequence
          Length = 1640

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 139  agaaattctccttgggaaa 157
            |||||||||||||||||||
Sbjct: 987  agaaattctccttgggaaa 1005
to top
>dbj|AK013892.1| Mus musculus 12 days embryo head cDNA, RIKEN full-length enriched
            library, clone:3010005B17 product:ADP-ribosylation factor
            4, full insert sequence
          Length = 1668

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 139  agaaattctccttgggaaa 157
            |||||||||||||||||||
Sbjct: 1015 agaaattctccttgggaaa 1033
to top
>dbj|AK081686.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
           library, clone:C130067E20 product:ADP-ribosylation
           factor 4, full insert sequence
          Length = 2042

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 966 agaaattctccttgggaaa 984
to top
>dbj|AK002302.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
            library, clone:0610007M21 product:ADP-ribosylation factor
            4, full insert sequence
          Length = 1641

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 139  agaaattctccttgggaaa 157
            |||||||||||||||||||
Sbjct: 988  agaaattctccttgggaaa 1006
to top
>gb|AC007064.27| Homo sapiens Chromosome 22q11 PAC Clone p87o8 in CES region, complete
              sequence
          Length = 124823

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 118    gctacatacatatgtgtaa 136
              |||||||||||||||||||
Sbjct: 105001 gctacatacatatgtgtaa 104983
to top
>gb|AC006548.22| Homo sapiens chromosome 22 clone p20k14 map 22q11, complete sequence
          Length = 200149

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 118   gctacatacatatgtgtaa 136
             |||||||||||||||||||
Sbjct: 42374 gctacatacatatgtgtaa 42356
to top
>dbj|AK054371.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330020K09
           product:unclassifiable, full insert sequence
          Length = 2010

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 62  tttctctaccttattatga 80
           |||||||||||||||||||
Sbjct: 360 tttctctaccttattatga 342
to top
>gb|AC008002.3|AC008002 Drosophila melanogaster, chromosome 2L, region 21D-21E, BAC clone
              BACR48E08, complete sequence
          Length = 182726

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 115    atagctacatacatatgtg 133
              |||||||||||||||||||
Sbjct: 163506 atagctacatacatatgtg 163524
to top
>gb|AC110770.4| Homo sapiens BAC clone RP11-159P15 from 2, complete sequence
          Length = 81099

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 126   catatgtgtaattagaaat 144
             |||||||||||||||||||
Sbjct: 60436 catatgtgtaattagaaat 60418
to top
>gb|AC079244.29| Mus musculus strain C57BL/6J chromosome 9 clone rp23-343k17, complete
             sequence
          Length = 223861

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 120   tacatacatatgtgtaatt 138
             |||||||||||||||||||
Sbjct: 72982 tacatacatatgtgtaatt 73000
to top
>gb|AC114480.2| Homo sapiens chromosome 3 clone RP11-755B10, complete sequence
          Length = 196773

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 139  agaaattctccttgggaaa 157
            |||||||||||||||||||
Sbjct: 9164 agaaattctccttgggaaa 9146
to top
>gb|AC092418.3| Homo sapiens chromosome 3 clone RP11-229A12, complete sequence
          Length = 164500

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 139    agaaattctccttgggaaa 157
              |||||||||||||||||||
Sbjct: 162356 agaaattctccttgggaaa 162338
to top
>dbj|AK211971.1| Mus musculus cDNA, clone:Y2G0123H07, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000022429, based on BLAT search
          Length = 409

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 113 agaaattctccttgggaaa 131
to top
>dbj|AK206349.1| Mus musculus cDNA, clone:Y2G0104I24, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000022429, based on BLAT search
          Length = 335

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 39  agaaattctccttgggaaa 57
to top
>gb|AF104238.1|HSARF4G6 Homo sapiens ADP-ribosylation factor 4 (ARF4) gene, exon 6 and
           complete cds
          Length = 1107

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 408 agaaattctccttgggaaa 426
to top
>gb|AE003589.4| Drosophila melanogaster chromosome 2L, section 2 of 83 of the complete
              sequence
          Length = 306076

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 115    atagctacatacatatgtg 133
              |||||||||||||||||||
Sbjct: 187961 atagctacatacatatgtg 187943
to top
>gb|AC005269.1|AC005269 Drosophila melanogaster DNA sequence (P1s DS00764 (D273) and DS00501
             (D274)), complete sequence
          Length = 104278

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 115   atagctacatacatatgtg 133
             |||||||||||||||||||
Sbjct: 57330 atagctacatacatatgtg 57312
to top
>gb|AC135353.3| Mus musculus BAC clone RP24-401C17 from 9, complete sequence
          Length = 132290

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 116   tagctacatacatatgtgtaatt 138
             ||||||||||||||||| |||||
Sbjct: 79523 tagctacatacatatgtttaatt 79501
to top
>emb|BX005190.8| Mouse DNA sequence from clone RP23-383A22 on chromosome X, complete
              sequence
          Length = 212955

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 50     cttggattattatttctct 68
              |||||||||||||||||||
Sbjct: 153833 cttggattattatttctct 153851
to top
>gb|AC096784.17| Mus musculus strain C57BL/6J chromosome 10 clone rp23-232l11, complete
             sequence
          Length = 202124

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 81    tgacccagaccataaaagggcag 103
             |||||||||||| ||||||||||
Sbjct: 50049 tgacccagaccaaaaaagggcag 50071
to top
>gb|AC140407.5| Mus musculus BAC clone RP23-142K9 from chromosome unknown, complete
              sequence
          Length = 193404

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 50     cttggattattatttctct 68
              |||||||||||||||||||
Sbjct: 131614 cttggattattatttctct 131632
to top
>emb|AL928671.6| Zebrafish DNA sequence from clone CH211-39M14, complete sequence
          Length = 173481

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 95    aaagggcaggttcttacattatagcta 121
             |||| ||||||||||||| ||||||||
Sbjct: 13132 aaagagcaggttcttacaatatagcta 13106
to top
>emb|AL671187.9| Mouse DNA sequence from clone RP23-273N4 on chromosome X, complete
              sequence
          Length = 205749

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 62     tttctctaccttattatga 80
              |||||||||||||||||||
Sbjct: 107522 tttctctaccttattatga 107540
to top
>gb|M36341.1|HUMARF4 Human ADP-ribosylation factor 4 (ARF4) mRNA, complete cds
          Length = 1529

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 862 agaaattctccttgggaaa 880
to top
>dbj|D87901.1| Mouse mRNA for ARF4, complete cds
          Length = 1107

 Score = 38.2 bits (19), Expect = 8.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 139 agaaattctccttgggaaa 157
           |||||||||||||||||||
Sbjct: 783 agaaattctccttgggaaa 801


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,695,334
Number of Sequences: 3902068
Number of extensions: 1695334
Number of successful extensions: 128625
Number of sequences better than 10.0: 77
Number of HSP's better than 10.0 without gapping: 77
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 128485
Number of HSP's gapped (non-prelim): 140
length of query: 175
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 153
effective length of database: 17,147,199,772
effective search space: 2623521565116
effective search space used: 2623521565116
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top