>gb|AC087731.2| Felis catus clone RP86-459O8, complete sequence
          Length = 125661

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 9     aaactttgtttcagaagtgtaa 30
             ||||||||||||||||||||||
Sbjct: 57368 aaactttgtttcagaagtgtaa 57389

>gb|AC007659.2|AC007659 Arabidopsis thaliana chromosome II section 241 of 255 of the complete
             sequence. Sequence from clones T13E15, T14P1
          Length = 87885

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 266   gataggcaactagtagtactttgtt 290
             |||| ||||||||||||||||||||
Sbjct: 86299 gataagcaactagtagtactttgtt 86275

>gb|AC110775.3| Homo sapiens BAC clone RP11-290O12 from 4, complete sequence
          Length = 210300

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 259   acatgaagataggcaactagtagt 282
             ||||||||| ||||||||||||||
Sbjct: 94212 acatgaagaaaggcaactagtagt 94235

>dbj|AP006077.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT46B01, TM0116,
              complete sequence
          Length = 121207

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 59     taaatttctctctcaactat 78
              ||||||||||||||||||||
Sbjct: 101246 taaatttctctctcaactat 101227


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,194,393
Number of Sequences: 3902068
Number of extensions: 2194393
Number of successful extensions: 37475
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37471
Number of HSP's gapped (non-prelim): 4
length of query: 294
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 272
effective length of database: 17,147,199,772
effective search space: 4664038337984
effective search space used: 4664038337984
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)