ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl15g10 |
|---|---|
| Clone Library Name | barley_pub |
>gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118, complete genome Length = 1827111 Score = 42.1 bits (21), Expect = 0.78 Identities = 21/21 (100%) Strand = Plus / Plus Query: 19 ctgataattataccaaacttt 39 ||||||||||||||||||||| Sbjct: 1401026 ctgataattataccaaacttt 1401046
>ref|XM_518367.1| PREDICTED: Pan troglodytes similar to Helicase SKI2W (Helicase-like protein) (HLP) (LOC462574), mRNA Length = 455 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 227 tcatgtttgacaatgcactg 246
>ref|NM_006929.4| Homo sapiens superkiller viralicidic activity 2-like (S. cerevisiae) (SKIV2L), mRNA Length = 4187 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3670 tcatgtttgacaatgcactg 3689
>gb|CP000057.1| Haemophilus influenzae strain 86-028NP, complete genome Length = 1913428 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 52 tttgacaatgcactgctgat 71 |||||||||||||||||||| Sbjct: 495988 tttgacaatgcactgctgat 496007
>gb|AF019413.1|HSMHCT8S22 Homo sapiens HLA class III region containing tenascin X (tenascin-X) gene, partial cds; cytochrome P450 21-hydroxylase (CYP21B), complement component C4 (C4B) G11, helicase (SKI2W), RD, complement factor B (Bf), and complement component C2 (C2) genes, complete cds Length = 109646 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 56573 tcatgtttgacaatgcactg 56554
>gb|AF049850.1|MMHC438N12 Mus musculus major histocompatibility locus class III region: complement C4 (C4) and cytochrome P450 hydroxylase A (CYP21OH-A) genes, complete cds; slp pseudogene, complete sequence; NG6, SKI, and complement factor B (Bf) genes, complete cds; and complement factor C2 (C2) gene, partial cds Length = 149886 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 114615 tcatgtttgacaatgcactg 114596
>gb|BC015758.1| Homo sapiens superkiller viralicidic activity 2-like (S. cerevisiae), mRNA (cDNA clone MGC:23108 IMAGE:4874270), complete cds Length = 3818 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3283 tcatgtttgacaatgcactg 3302
>ref|NM_021337.2| Mus musculus superkiller viralicidic activity 2-like (S. cerevisiae ) (Skiv2l), mRNA Length = 3972 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3324 tcatgtttgacaatgcactg 3343
>ref|XM_745943.1| Aspergillus fumigatus Af293 hypothetical protein (Afu6g11530) partial mRNA Length = 438 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 ctgctgataaacaacggcga 83 |||||||||||||||||||| Sbjct: 278 ctgctgataaacaacggcga 259
>gb|BC062925.1| Mus musculus superkiller viralicidic activity 2-like (S. cerevisiae ), mRNA (cDNA clone IMAGE:6850994), partial cds Length = 4010 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3379 tcatgtttgacaatgcactg 3398
>emb|AL662849.8| Human DNA sequence from clone XXbac-116I9 on chromosome 6 contains the C2 gene for complement component 2, the Bf gene for B-factor, properdin, the RDBP gene for RD RNA-binding protein, the SKIV2L gene for superkiller viralicidic activity 2-like (S. cerevisiae), the DOM3Z gene for dom-3 homolog Z (C. elegans), the STK19 gene for serine/threonine kinase 19, the C4A gene for complement component 4B, the 3' end of the CYP21A2 gene for cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2 and four CpG islands, complete sequence Length = 88459 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 55138 tcatgtttgacaatgcactg 55157
>gb|AC129091.19| Medicago truncatula clone mth2-15j7, complete sequence Length = 106540 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 115 aaagttacactcttatcaaa 134 |||||||||||||||||||| Sbjct: 92380 aaagttacactcttatcaaa 92361
>emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on chromosome 6 Contains the NEU1 gene for sialidase 1 (lysosomal sialidase), the C6orf29 gene for chromosome 6 open reading frame 29, the BAT8 gene for HLA-B associated transcript 8, a novel transcript DAQB-331I12.5, the ZBTB12 gene (previously C6orf46) for zinc finger and BTB domain containing 12, the C2 gene for complement component 2, the Bf gene for B-factor, properdin, the RDBP gene for RD RNA binding protein, the SKIV2L gene for superkiller viralicidic activity 2-like (S. cerevisiae), the DOM3Z gene for dom-3 homolog Z (C. elegans), the STK19 gene for serine/threonine kinase 19, the 5' end of the C4A gene for complement component 4A and 8 CpG isalnds, complete sequence Length = 153464 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 123094 tcatgtttgacaatgcactg 123113
>ref|NG_000013.2| Homo sapiens MHC class III complement gene cluster, monomodular haplotype (MCGC@) on chromosome 6 Length = 180017 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 126944 tcatgtttgacaatgcactg 126925
>gb|BC065999.1| Mus musculus superkiller viralicidic activity 2-like (S. cerevisiae ), mRNA (cDNA clone MGC:90095 IMAGE:5686586), complete cds Length = 3939 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3296 tcatgtttgacaatgcactg 3315
>emb|AL353573.10| Human DNA sequence from clone RP11-550E18 on chromosome 9 Contains a solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 (SLC25A5) (ANT2) pseudogene, complete sequence Length = 166664 Score = 40.1 bits (20), Expect = 3.1 Identities = 26/28 (92%) Strand = Plus / Plus Query: 202 tttacaacacagcgaaaacgaacaaata 229 |||||| ||||| ||||||||||||||| Sbjct: 20150 tttacagcacagtgaaaacgaacaaata 20177
>emb|CR753845.11| Human DNA sequence from clone DADB-112B14 on chromosome 6, complete sequence Length = 96090 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 14098 tcatgtttgacaatgcactg 14117
>emb|BX883045.1| Rattus norvegicus chromosome 20, major histocompatibility complex, assembled from 40 BACs, strain Brown Norway (BN/ssNHsd), RT1n haplotype; segment 4/11 Length = 346406 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 28259 tcatgtttgacaatgcactg 28240
>emb|AL645922.11| Human DNA sequence from clone XXbac-116M5 on chromosome 6 contains the C2 gene for complement component 2 (C2, CO2), the Bf gene for B-factor, properdin (Bf, GBG, CFAB, PBF2), the RDBP gene for RD RNA-binding protein (RDBP, RD, RDP, D6S45, NELF-E), the SKIV2L gene for superkiller viralicidic activity 2-like (S. cerevisiae) (SKIV2L, HLP, SKI2, DDX13, SKI2W, SKIV2), the DOM3Z gene for dom-3 homolog Z (C. elegans) (DOM3Z, NG6, DOM3L), the STK19 gene for serine/threonine kinase 19 (STK19, G11, RP1, D6S60, D6S60E, HLA-RP1), the C4A gene for complement component 4A (C4A, C4S, CO4), a cytochrome P450, subfamily XXIA (steroid 21-hydroxylase), polypeptide 1 pseudogene (CYP21A1P), a tenascin XA pseudogene (TNXA, XA, XB, TNX, HXBL, D6S103E), a serine/threonine kinase 19 (STK19, G11, RP1, D6S60, D6S60E, HLA-RP1) pseudogene, the C4B gene for complement component 4B (C4B, C4F, CO4), the CYP21A2 gene for cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2 (CYP21A2, CAH1, CPS1, CA21H, CYP21, CYP21B, P450c21B), the 3' end of the TNXB gene for tenascin XB (TNXB, XB, TNX, XBS, HXBL, TENX, TNXB1, TNXB2, TNXBS) and four CpG islands, complete sequence Length = 180559 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 65237 tcatgtttgacaatgcactg 65256
>emb|AL049547.10|HSDJ34F7 Human DNA sequence from clone RP1-34F7 on chromosome 6p21.2-21.33 Contains the 3' end of the gene for CREB-RP (G13), the gene for tenascin XB and XA, the CYP21A2 gene for cytochrome P450, subfamily XXIA (steroid 21-hydroxylase), polypeptide 2 (CYP21, P450c21B), the C4A gene for complement component 4A, the gene for RP MHC class III complement protein (G11), the DOM3Z gene for DOM-3 (C. elegans) homolog Z, the SKIV2L gene for superkiller viralicidic activity 2 (S. cerevisiae homolog)-like (SKI2W) and the gene for RD (RDBP). Contains ESTs, STSs, GSSs and five putative CpG islands, complete sequence Length = 129811 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 117007 tcatgtttgacaatgcactg 116988
>emb|CR759782.7| Human DNA sequence from clone DAMC-178C20 on chromosome 6, complete sequence Length = 79825 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 66745 tcatgtttgacaatgcactg 66764
>emb|CR788238.10| Human DNA sequence from clone DAMC-45E14 on chromosome 6, complete sequence Length = 108340 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 2849 tcatgtttgacaatgcactg 2830
>emb|CR753822.3| Human DNA sequence from clone DASS-264H16 on chromosome 6, complete sequence Length = 10388 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 5250 tcatgtttgacaatgcactg 5269
>emb|CR616648.1| full-length cDNA clone CS0CAP003YA05 of Thymus of Homo sapiens (human) Length = 518 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 22 tcatgtttgacaatgcactg 41
>dbj|AK139051.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:A730004N10 product:Similar to superkiller viralicidic activity 2-like (S. cerevisiae) (Fragment) homolog [Mus musculus], full insert sequence Length = 4121 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3398 tcatgtttgacaatgcactg 3417
>ref|NG_004658.1| Homo sapiens MHC class III complement gene cluster, bimodular haplotype (MCGC2@) on chromosome 6 Length = 201523 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 41755 tcatgtttgacaatgcactg 41774
>dbj|AK159854.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420034G16 product:Superkiller viralicidic activity 2-like, full insert sequence Length = 3966 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3325 tcatgtttgacaatgcactg 3344
>dbj|AK029763.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930534J06 product:superkiller viralicidic activity 2-like (S. cerevisiae ), full insert sequence Length = 3907 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3313 tcatgtttgacaatgcactg 3332
>gb|AC149135.2| Medicago truncatula chromosome 2 BAC clone mth2-31g23, complete sequence Length = 113812 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 115 aaagttacactcttatcaaa 134 |||||||||||||||||||| Sbjct: 94991 aaagttacactcttatcaaa 95010
>gb|BC023478.1| Mus musculus superkiller viralicidic activity 2-like (S. cerevisiae ), mRNA (cDNA clone IMAGE:5007559), partial cds Length = 2541 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 1928 tcatgtttgacaatgcactg 1947
>ref|NG_005163.1| Homo sapiens MHC class III complement gene cluster, monomodular haplotype (MCGC3@) on chromosome 6 Length = 164376 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 41755 tcatgtttgacaatgcactg 41774
>dbj|AK087810.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN full-length enriched library, clone:E330024C01 product:superkiller viralicidic activity 2-like (S. cerevisiae ), full insert sequence Length = 4528 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3960 tcatgtttgacaatgcactg 3979
>gb|U09877.1|HSU09877 Human helicase-like protein (HLP) mRNA, complete cds Length = 3909 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3392 tcatgtttgacaatgcactg 3411
>ref|NM_213559.1| Rattus norvegicus superkiller viralicidic activity 2-like (Skiv2l), mRNA Length = 3770 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3310 tcatgtttgacaatgcactg 3329
>emb|AL731729.10| Mouse DNA sequence from clone RP23-92L12 on chromosome X, complete sequence Length = 216656 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 109 acagataaagttacactctt 128 |||||||||||||||||||| Sbjct: 39645 acagataaagttacactctt 39626
>gb|AF059675.1|AF059675 Homo sapiens putative RNA helicase Ski2w (SKI2W) gene, complete cds Length = 11008 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 9912 tcatgtttgacaatgcactg 9931
>emb|CT025759.14| Mouse DNA sequence from clone RP24-317H19 on chromosome 17, complete sequence Length = 171682 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 68143 tcatgtttgacaatgcactg 68124
>gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome Length = 1830138 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 52 tttgacaatgcactgctgat 71 |||||||||||||||||||| Sbjct: 428871 tttgacaatgcactgctgat 428890
>dbj|AB209605.1| Homo sapiens mRNA for DJ34F7.7 (Superkiller viralicidic activity 2 -like variant protein Length = 4497 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3910 tcatgtttgacaatgcactg 3929
>dbj|AP007294.1| Lotus japonicus genomic DNA, clone:LjT42E17, TM0355, complete sequence Length = 124602 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 125 tcttatcaaagtcgaaaaca 144 |||||||||||||||||||| Sbjct: 118575 tcttatcaaagtcgaaaaca 118594
>emb|Z48796.1|HSSKIWMR H.sapiens Ski-W mRNA for helicase Length = 3874 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3333 tcatgtttgacaatgcactg 3352
>emb|X98378.1|HSSKI2WGN H.sapiens SKI2W gene Length = 3796 Score = 40.1 bits (20), Expect = 3.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 47 tcatgtttgacaatgcactg 66 |||||||||||||||||||| Sbjct: 3286 tcatgtttgacaatgcactg 3305 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,163,587 Number of Sequences: 3902068 Number of extensions: 2163587 Number of successful extensions: 36943 Number of sequences better than 10.0: 42 Number of HSP's better than 10.0 without gapping: 42 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 36885 Number of HSP's gapped (non-prelim): 58 length of query: 240 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 218 effective length of database: 17,147,199,772 effective search space: 3738089550296 effective search space used: 3738089550296 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
