ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl15f05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CR381531.7| Zebrafish DNA sequence from clone DKEY-190G6 in ... 44 0.30
2gb|AC167421.2| Mus musculus BAC clone RP23-143K19 from chromosom... 40 4.6
3gb|AC154227.2| Mus musculus BAC clone RP24-142A23 from chromosom... 40 4.6
4gb|AE014837.1| Plasmodium falciparum 3D7 chromosome 11 section 2... 40 4.6
5emb|AL603845.11| Mouse DNA sequence from clone RP23-145C12 on ch... 40 4.6
6gb|AC007295.8| Arabidopsis thaliana chromosome 2 clone T4E5 map ... 40 4.6
7dbj|AK084566.1| Mus musculus 13 days embryo heart cDNA, RIKEN fu... 40 4.6
8gb|AC019102.13| Homo sapiens BAC clone RP11-457A20 from 2, compl... 40 4.6
9dbj|BA000016.3| Clostridium perfringens str. 13 DNA, complete ge... 40 4.6
10gb|AC132008.5| Homo sapiens 3 BAC RP11-594G13 (Roswell Park Canc... 40 4.6

>emb|CR381531.7| Zebrafish DNA sequence from clone DKEY-190G6 in linkage group 23,
             complete sequence
          Length = 149672

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 166   tcccaacaaatattggttaact 187
             ||||||||||||||||||||||
Sbjct: 70625 tcccaacaaatattggttaact 70604



to top

>gb|AC167421.2| Mus musculus BAC clone RP23-143K19 from chromosome 3, complete sequence
          Length = 194311

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    tatataaacaagatgataat 52
             ||||||||||||||||||||
Sbjct: 79011 tatataaacaagatgataat 79030



to top

>gb|AC154227.2| Mus musculus BAC clone RP24-142A23 from chromosome 14, complete sequence
          Length = 156644

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 141    aatctaaccctagtgttcct 160
              ||||||||||||||||||||
Sbjct: 100549 aatctaaccctagtgttcct 100568



to top

>gb|AE014837.1| Plasmodium falciparum 3D7 chromosome 11 section 2 of 8 of the complete
              sequence
          Length = 257757

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 28     aagaatatataaacaagatg 47
              ||||||||||||||||||||
Sbjct: 154394 aagaatatataaacaagatg 154413



to top

>emb|AL603845.11| Mouse DNA sequence from clone RP23-145C12 on chromosome 11 Contains a
             ribosomal protein L7a (Rpl7a) pseudogene and the 3' end of
             the gene for a novel protein similar to Tensin Tns,
             complete sequence
          Length = 223491

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 34    atataaacaagatgataata 53
             ||||||||||||||||||||
Sbjct: 28497 atataaacaagatgataata 28516



to top

>gb|AC007295.8| Arabidopsis thaliana chromosome 2 clone T4E5 map PR1, complete sequence
          Length = 62915

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 35    tataaacaagatgataatag 54
             ||||||||||||||||||||
Sbjct: 49892 tataaacaagatgataatag 49873



to top

>dbj|AK084566.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched
            library, clone:D330015K09 product:unclassifiable, full
            insert sequence
          Length = 3762

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 33   tatataaacaagatgataat 52
            ||||||||||||||||||||
Sbjct: 1133 tatataaacaagatgataat 1152



to top

>gb|AC019102.13| Homo sapiens BAC clone RP11-457A20 from 2, complete sequence
          Length = 158242

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 52    taggacatgaggaaaatgccgccaagtt 79
             ||||||||||| | ||||||||||||||
Sbjct: 19243 taggacatgagcacaatgccgccaagtt 19270



to top

>dbj|BA000016.3| Clostridium perfringens str. 13 DNA, complete genome
          Length = 3031430

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 211     aaaaatattcccagacaaac 230
               ||||||||||||||||||||
Sbjct: 2748150 aaaaatattcccagacaaac 2748131



to top

>gb|AC132008.5| Homo sapiens 3 BAC RP11-594G13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 51528

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 317   agtctcaacagtagaacaga 336
             ||||||||||||||||||||
Sbjct: 13730 agtctcaacagtagaacaga 13749


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,187,273
Number of Sequences: 3902068
Number of extensions: 3187273
Number of successful extensions: 56953
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56925
Number of HSP's gapped (non-prelim): 28
length of query: 348
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 326
effective length of database: 17,147,199,772
effective search space: 5589987125672
effective search space used: 5589987125672
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top