Clone Name | rbastl15f05 |
---|---|
Clone Library Name | barley_pub |
>emb|CR381531.7| Zebrafish DNA sequence from clone DKEY-190G6 in linkage group 23, complete sequence Length = 149672 Score = 44.1 bits (22), Expect = 0.30 Identities = 22/22 (100%) Strand = Plus / Minus Query: 166 tcccaacaaatattggttaact 187 |||||||||||||||||||||| Sbjct: 70625 tcccaacaaatattggttaact 70604
>gb|AC167421.2| Mus musculus BAC clone RP23-143K19 from chromosome 3, complete sequence Length = 194311 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 tatataaacaagatgataat 52 |||||||||||||||||||| Sbjct: 79011 tatataaacaagatgataat 79030
>gb|AC154227.2| Mus musculus BAC clone RP24-142A23 from chromosome 14, complete sequence Length = 156644 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 141 aatctaaccctagtgttcct 160 |||||||||||||||||||| Sbjct: 100549 aatctaaccctagtgttcct 100568
>gb|AE014837.1| Plasmodium falciparum 3D7 chromosome 11 section 2 of 8 of the complete sequence Length = 257757 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 28 aagaatatataaacaagatg 47 |||||||||||||||||||| Sbjct: 154394 aagaatatataaacaagatg 154413
>emb|AL603845.11| Mouse DNA sequence from clone RP23-145C12 on chromosome 11 Contains a ribosomal protein L7a (Rpl7a) pseudogene and the 3' end of the gene for a novel protein similar to Tensin Tns, complete sequence Length = 223491 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 atataaacaagatgataata 53 |||||||||||||||||||| Sbjct: 28497 atataaacaagatgataata 28516
>gb|AC007295.8| Arabidopsis thaliana chromosome 2 clone T4E5 map PR1, complete sequence Length = 62915 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 tataaacaagatgataatag 54 |||||||||||||||||||| Sbjct: 49892 tataaacaagatgataatag 49873
>dbj|AK084566.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330015K09 product:unclassifiable, full insert sequence Length = 3762 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 33 tatataaacaagatgataat 52 |||||||||||||||||||| Sbjct: 1133 tatataaacaagatgataat 1152
>gb|AC019102.13| Homo sapiens BAC clone RP11-457A20 from 2, complete sequence Length = 158242 Score = 40.1 bits (20), Expect = 4.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 52 taggacatgaggaaaatgccgccaagtt 79 ||||||||||| | |||||||||||||| Sbjct: 19243 taggacatgagcacaatgccgccaagtt 19270
>dbj|BA000016.3| Clostridium perfringens str. 13 DNA, complete genome Length = 3031430 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 211 aaaaatattcccagacaaac 230 |||||||||||||||||||| Sbjct: 2748150 aaaaatattcccagacaaac 2748131
>gb|AC132008.5| Homo sapiens 3 BAC RP11-594G13 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 51528 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 317 agtctcaacagtagaacaga 336 |||||||||||||||||||| Sbjct: 13730 agtctcaacagtagaacaga 13749 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,187,273 Number of Sequences: 3902068 Number of extensions: 3187273 Number of successful extensions: 56953 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 56925 Number of HSP's gapped (non-prelim): 28 length of query: 348 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 326 effective length of database: 17,147,199,772 effective search space: 5589987125672 effective search space used: 5589987125672 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)