ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl14h04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY028079.1| Homo sapiens putative protein and FSHD Region Gen... 44 0.32
2emb|AL845259.22| Human DNA sequence from clone XX-2136C77 on chr... 44 0.32
3gb|AF117653.2| Homo sapiens double homeobox protein genes, compl... 44 0.32
4gb|U85056.1|HSU85056 Homo sapiens FSHD-associated repeat DNA, pr... 44 0.32
5dbj|D38025.1| Homo sapiens DNA for repeat sequence 44 0.32
6gb|AC069444.17| Homo sapiens 3 BAC RP11-169N13 (Roswell Park Can... 42 1.3
7ref|NM_001009084.1| Pan troglodytes protamine 2 (PRM2), mRNA 42 1.3
8gb|AF215714.1|AF215714 Pongo pygmaeus protamine 2 (PRM2) gene, c... 42 1.3
9emb|X72968.1|PTPROP2 P.troglodytes gene for pro-protamine P2 42 1.3
10emb|X71337.1|PPYPROP2 P.pygmaeus gene for protamine P2 42 1.3
11gb|AC124404.4| Mus musculus BAC clone RP24-371M10 from chromosom... 40 4.9
12gb|AC112163.7| Mus Musculus chromosome 13 BAC, clone MGS1-437011... 40 4.9
13gb|AC145456.1| Cicer arietinum strain FLIP84-92C clone gl1-15o9,... 40 4.9
14gb|AC090138.5| Homo sapiens, clone RP11-63C8, complete sequence 40 4.9
15gb|AC016845.14| Homo sapiens chromosome 11, clone RP11-5E23, com... 40 4.9
16emb|AL135978.4|CNS01DVN Human chromosome 14 DNA sequence BAC R-1... 40 4.9
17gb|AC153654.4| Mus musculus BAC clone RP23-457N11 from chromosom... 40 4.9

>gb|AY028079.1| Homo sapiens putative protein and FSHD Region Gene 2 protein (HSA10-FRG2)
              genes, complete cds
          Length = 126625

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 9      aactgaattttaacaaataaag 30
              ||||||||||||||||||||||
Sbjct: 115204 aactgaattttaacaaataaag 115183



to top

>emb|AL845259.22| Human DNA sequence from clone XX-2136C77 on chromosome 10 Contains a
             novel pseudogene, complete sequence
          Length = 39002

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 9     aactgaattttaacaaataaag 30
             ||||||||||||||||||||||
Sbjct: 11947 aactgaattttaacaaataaag 11926



to top

>gb|AF117653.2| Homo sapiens double homeobox protein genes, complete cds
          Length = 13477

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 9    aactgaattttaacaaataaag 30
            ||||||||||||||||||||||
Sbjct: 3808 aactgaattttaacaaataaag 3787



to top

>gb|U85056.1|HSU85056 Homo sapiens FSHD-associated repeat DNA, proximal region
          Length = 27574

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 9     aactgaattttaacaaataaag 30
             ||||||||||||||||||||||
Sbjct: 23194 aactgaattttaacaaataaag 23173



to top

>dbj|D38025.1| Homo sapiens DNA for repeat sequence
          Length = 2534

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 9   aactgaattttaacaaataaag 30
           ||||||||||||||||||||||
Sbjct: 599 aactgaattttaacaaataaag 578



to top

>gb|AC069444.17| Homo sapiens 3 BAC RP11-169N13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 165093

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1     aaataaggaactgaattttaa 21
             |||||||||||||||||||||
Sbjct: 56503 aaataaggaactgaattttaa 56523



to top

>ref|NM_001009084.1| Pan troglodytes protamine 2 (PRM2), mRNA
          Length = 596

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 289 gcgatgcttcctccggtgcct 309
           |||||||||||||||||||||
Sbjct: 325 gcgatgcttcctccggtgcct 305



to top

>gb|AF215714.1|AF215714 Pongo pygmaeus protamine 2 (PRM2) gene, complete cds
          Length = 944

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 289 gcgatgcttcctccggtgcct 309
           |||||||||||||||||||||
Sbjct: 677 gcgatgcttcctccggtgcct 657



to top

>emb|X72968.1|PTPROP2 P.troglodytes gene for pro-protamine P2
          Length = 758

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 289 gcgatgcttcctccggtgcct 309
           |||||||||||||||||||||
Sbjct: 325 gcgatgcttcctccggtgcct 305



to top

>emb|X71337.1|PPYPROP2 P.pygmaeus gene for protamine P2
          Length = 696

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 289 gcgatgcttcctccggtgcct 309
           |||||||||||||||||||||
Sbjct: 267 gcgatgcttcctccggtgcct 247



to top

>gb|AC124404.4| Mus musculus BAC clone RP24-371M10 from chromosome 12, complete
             sequence
          Length = 150375

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 14    aattttaacaaataaagcac 33
             ||||||||||||||||||||
Sbjct: 28344 aattttaacaaataaagcac 28325



to top

>gb|AC112163.7| Mus Musculus chromosome 13 BAC, clone MGS1-437011 ES cell line, Complete
              Sequence, complete sequence
          Length = 159042

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 259    gtcatccttgtgtttccttt 278
              ||||||||||||||||||||
Sbjct: 144090 gtcatccttgtgtttccttt 144071



to top

>gb|AC145456.1| Cicer arietinum strain FLIP84-92C clone gl1-15o9, complete sequence
          Length = 45868

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    actgaattttaacaaataaa 29
             ||||||||||||||||||||
Sbjct: 42657 actgaattttaacaaataaa 42638



to top

>gb|AC090138.5| Homo sapiens, clone RP11-63C8, complete sequence
          Length = 189231

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      aataaggaactgaattttaa 21
              ||||||||||||||||||||
Sbjct: 134357 aataaggaactgaattttaa 134376



to top

>gb|AC016845.14| Homo sapiens chromosome 11, clone RP11-5E23, complete sequence
          Length = 167727

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      aataaggaactgaattttaa 21
              ||||||||||||||||||||
Sbjct: 116350 aataaggaactgaattttaa 116331



to top

>emb|AL135978.4|CNS01DVN Human chromosome 14 DNA sequence BAC R-125H8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 173043

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 2     aataaggaactgaattttaa 21
             ||||||||||||||||||||
Sbjct: 30884 aataaggaactgaattttaa 30903



to top

>gb|AC153654.4| Mus musculus BAC clone RP23-457N11 from chromosome 12, complete sequence
          Length = 193547

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     aattttaacaaataaagcac 33
              ||||||||||||||||||||
Sbjct: 117582 aattttaacaaataaagcac 117563


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,068,053
Number of Sequences: 3902068
Number of extensions: 4068053
Number of successful extensions: 68421
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 17
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68400
Number of HSP's gapped (non-prelim): 21
length of query: 371
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 349
effective length of database: 17,147,199,772
effective search space: 5984372720428
effective search space used: 5984372720428
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top