>gb|AC112908.3| Homo sapiens 3 BAC RP11-657F23 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 111304

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 139  agtacataatactagtagatac 160
            ||||||||||||||||||||||
Sbjct: 5447 agtacataatactagtagatac 5426

>gb|AC007866.11| Trypanosoma brucei chromosome 2 clone RPCI93-36E18, complete sequence
          Length = 110159

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 171    acatacgctacaacaactga 190
              ||||||||||||||||||||
Sbjct: 102889 acatacgctacaacaactga 102870

>gb|AE017150.2| Trypanosoma brucei chromosome 2, complete sequence
          Length = 1193948

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 171     acatacgctacaacaactga 190
               ||||||||||||||||||||
Sbjct: 1186678 acatacgctacaacaactga 1186659

>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
               genome
          Length = 3397754

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 281     atggttagctcagctgtgat 300
               ||||||||||||||||||||
Sbjct: 2355533 atggttagctcagctgtgat 2355514

>gb|AC115116.6| Mus musculus BAC clone RP23-62I3 from chromosome 1, complete sequence
          Length = 231896

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 138    gagtacataatactagtaga 157
              ||||||||||||||||||||
Sbjct: 129280 gagtacataatactagtaga 129261

>ref|XM_946664.1| Trypanosoma brucei TREU927 variant surface glycoprotein
           (Tb927.2.6410) partial mRNA
          Length = 1431

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 171 acatacgctacaacaactga 190
           ||||||||||||||||||||
Sbjct: 811 acatacgctacaacaactga 830

>emb|AL121990.34|HSDJ613A2 Human DNA sequence from clone RP4-613A2 on chromosome 1q42.11-42.3
             Contains the 5' end of the NUP133 gene, a novel gene, the
             ABCB10 gene for ATP-binding cassette, sub-family B
             (MDR/TAP), member 10, a high-mobility group nucleosomal
             binding domain 2 (HMGN2) pseudogene, the TAF5L gene for
             TAF5-like RNA polymerase II, p300/CBP-associated factor
             (PCAF)-associated factor, 65kDa, the 5' end of a novel
             gene (KIAA0133) and three CpG islands, complete sequence
          Length = 147913

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   gttcagtgatagatactaca 262
             ||||||||||||||||||||
Sbjct: 47219 gttcagtgatagatactaca 47200

>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 207     gccagccaggcggccaagtc 226
               ||||||||||||||||||||
Sbjct: 1627979 gccagccaggcggccaagtc 1627960

>emb|CR354549.7| Zebrafish DNA sequence from clone CH211-151O16 in linkage group 25,
             complete sequence
          Length = 136578

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 140   gtacataatactagtagata 159
             ||||||||||||||||||||
Sbjct: 29208 gtacataatactagtagata 29189


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,270,302
Number of Sequences: 3902068
Number of extensions: 2270302
Number of successful extensions: 38141
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38106
Number of HSP's gapped (non-prelim): 35
length of query: 354
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 332
effective length of database: 17,147,199,772
effective search space: 5692870324304
effective search space used: 5692870324304
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)