ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl14e08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC164437.2| Mus musculus BAC clone RP23-105B9 from chromosome... 40 4.3
2gb|AE009186.1| Agrobacterium tumefaciens str. C58 circular chrom... 40 4.3
3gb|AC091524.4| Homo sapiens BAC clone RP11-132L11 from 7, comple... 40 4.3
4emb|AL513264.8| Human DNA sequence from clone RP11-480H3 on chro... 40 4.3
5gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome 40 4.3
6dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome 40 4.3
7gb|AC034150.6| Homo sapiens BAC clone RP11-167N19 from 4, comple... 40 4.3
8gb|AC024159.4|AC024159 Homo sapiens chromosome 3 clone RP11-255K... 40 4.3
9gb|AC026197.3|AC026197 Homo sapiens chromosome 3 clone RP11-483G... 40 4.3
10gb|AC020755.3|AC020755 Homo sapiens chromosome 3 clone RP11-3D22... 40 4.3
11gb|AC025920.12|AC025920 Homo sapiens chromosome N/A clone RP11-2... 40 4.3
12emb|BX000352.8| Mouse DNA sequence from clone RP23-472K10 on chr... 40 4.3
13emb|CT025614.7| Mouse DNA sequence from clone RP23-418B18 on chr... 40 4.3
14gb|AC024162.5| Homo sapiens chromosome 3 clone RP11-320K1 map 3p... 40 4.3

>gb|AC164437.2| Mus musculus BAC clone RP23-105B9 from chromosome 14, complete sequence
          Length = 205044

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    aaccccaaaaggtagcaaac 93
             ||||||||||||||||||||
Sbjct: 10535 aaccccaaaaggtagcaaac 10516



to top

>gb|AE009186.1| Agrobacterium tumefaciens str. C58 circular chromosome, section 212
            of 256 of the complete sequence
          Length = 11420

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 243  acattccgtggcatcgagga 262
            ||||||||||||||||||||
Sbjct: 8725 acattccgtggcatcgagga 8706



to top

>gb|AC091524.4| Homo sapiens BAC clone RP11-132L11 from 7, complete sequence
          Length = 69887

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 230   ttttttctaatccacattcc 249
             ||||||||||||||||||||
Sbjct: 51916 ttttttctaatccacattcc 51935



to top

>emb|AL513264.8| Human DNA sequence from clone RP11-480H3 on chromosome 6, complete
             sequence
          Length = 90015

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    aataataataacatgcaaca 37
             ||||||||||||||||||||
Sbjct: 14437 aataataataacatgcaaca 14418



to top

>gb|AE007869.1| Agrobacterium tumefaciens str. C58, complete genome
          Length = 2841581

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 243     acattccgtggcatcgagga 262
               ||||||||||||||||||||
Sbjct: 2356488 acattccgtggcatcgagga 2356469



to top

>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome
          Length = 2088737

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 43      gggcggcaatattaacacctaaat 66
               ||||||||||||||||||| ||||
Sbjct: 1252854 gggcggcaatattaacaccgaaat 1252877



to top

>gb|AC034150.6| Homo sapiens BAC clone RP11-167N19 from 4, complete sequence
          Length = 150167

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 184    aattgtgcaaagcaaggaca 203
              ||||||||||||||||||||
Sbjct: 130313 aattgtgcaaagcaaggaca 130332



to top

>gb|AC024159.4|AC024159 Homo sapiens chromosome 3 clone RP11-255K15 map 3p, complete sequence
          Length = 195544

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 18   aataataataacatgcaaca 37
            ||||||||||||||||||||
Sbjct: 9617 aataataataacatgcaaca 9636



to top

>gb|AC026197.3|AC026197 Homo sapiens chromosome 3 clone RP11-483G20 map 3p, complete sequence
          Length = 202083

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    aataataataacatgcaaca 37
             ||||||||||||||||||||
Sbjct: 78556 aataataataacatgcaaca 78575



to top

>gb|AC020755.3|AC020755 Homo sapiens chromosome 3 clone RP11-3D22 map 3p, complete sequence
          Length = 166076

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    aataataataacatgcaaca 37
             ||||||||||||||||||||
Sbjct: 43560 aataataataacatgcaaca 43579



to top

>gb|AC025920.12|AC025920 Homo sapiens chromosome N/A clone RP11-277D17, complete sequence
          Length = 161489

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     aataataataacatgcaaca 37
              ||||||||||||||||||||
Sbjct: 138233 aataataataacatgcaaca 138252



to top

>emb|BX000352.8| Mouse DNA sequence from clone RP23-472K10 on chromosome X, complete
            sequence
          Length = 102363

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 9    gagtagtgtaataataataa 28
            ||||||||||||||||||||
Sbjct: 8095 gagtagtgtaataataataa 8076



to top

>emb|CT025614.7| Mouse DNA sequence from clone RP23-418B18 on chromosome 13, complete
             sequence
          Length = 183907

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 1     gctaaactgagtagtgtaat 20
             ||||||||||||||||||||
Sbjct: 73551 gctaaactgagtagtgtaat 73532



to top

>gb|AC024162.5| Homo sapiens chromosome 3 clone RP11-320K1 map 3p, complete sequence
          Length = 173370

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 18    aataataataacatgcaaca 37
             ||||||||||||||||||||
Sbjct: 97201 aataataataacatgcaaca 97220


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,777,620
Number of Sequences: 3902068
Number of extensions: 3777620
Number of successful extensions: 75728
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75684
Number of HSP's gapped (non-prelim): 44
length of query: 325
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 303
effective length of database: 17,147,199,772
effective search space: 5195601530916
effective search space used: 5195601530916
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top