ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl14e04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY106982.1| Zea mays PCO102337 mRNA sequence 44 0.21
2ref|NM_184232.2| Oryza sativa (japonica cultivar-group), mRNA 42 0.83
3dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.83
4dbj|AP002526.1| Oryza sativa (japonica cultivar-group) genomic D... 42 0.83
5dbj|AK102309.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 0.83
6dbj|AK063966.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 0.83
7gb|CP000025.1| Campylobacter jejuni RM1221, complete genome 40 3.3
8gb|AF381694.1| Uncultured chlorophyte clone 994AY17 ribulose 1,5... 40 3.3
9gb|AF381698.1| Uncultured chlorophyte clone 994AY7 ribulose 1,5-... 40 3.3
10gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome 40 3.3
11emb|AL160010.14| Human DNA sequence from clone RP11-146P20 on ch... 40 3.3
12emb|AL139076.2|CJ11168X3 Campylobacter jejuni subsp. jejuni NCTC... 40 3.3
13emb|BX901956.4| Zebrafish DNA sequence from clone CH211-284C12 i... 40 3.3
14gb|AC097061.2| Homo sapiens chromosome 1 clone RP11-415L24, comp... 40 3.3
15gb|AC018793.12| Homo sapiens chromosome 11, clone RP11-437G21, c... 40 3.3
16gb|AY232508.1| Donacia japana isolate N264 cytochrome oxidase su... 40 3.3
17gb|AY232507.1| Donacia japana isolate N119 cytochrome oxidase su... 40 3.3
18gb|AY232506.1| Donacia japana isolate N79 cytochrome oxidase sub... 40 3.3
19gb|AY157477.1| Uncultured marine eukaryote clone T7ASY6 ribulose... 40 3.3
20gb|AY157468.1| Uncultured marine eukaryote clone T5SY4 ribulose-... 40 3.3
21gb|AC010894.10| Homo sapiens BAC clone RP11-483E17 from 2, compl... 40 3.3
22dbj|AB005236.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 3.3
23ref|XM_315898.2| Anopheles gambiae str. PEST ENSANGP00000004512 ... 40 3.3
24emb|AL935200.9| Zebrafish DNA sequence from clone CH211-237I5, c... 40 3.3

>gb|AY106982.1| Zea mays PCO102337 mRNA sequence
          Length = 641

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 224 cctatgcttcgatgtgcatgttccatgtca 253
           |||||||||||||  |||||||||||||||
Sbjct: 207 cctatgcttcgatccgcatgttccatgtca 236



to top

>ref|NM_184232.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3193

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 225  ctatgcttcgatgtgcatgttccatgtca 253
            |||||||||||| ||||||||||| ||||
Sbjct: 3034 ctatgcttcgatctgcatgttccaagtca 3006



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 225     ctatgcttcgatgtgcatgttccatgtca 253
               |||||||||||| ||||||||||| ||||
Sbjct: 1701639 ctatgcttcgatctgcatgttccaagtca 1701611



to top

>dbj|AP002526.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0504H10
          Length = 143515

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 225   ctatgcttcgatgtgcatgttccatgtca 253
             |||||||||||| ||||||||||| ||||
Sbjct: 43982 ctatgcttcgatctgcatgttccaagtca 43954



to top

>dbj|AK102309.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033090B18, full
            insert sequence
          Length = 3486

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 225  ctatgcttcgatgtgcatgttccatgtca 253
            |||||||||||| ||||||||||| ||||
Sbjct: 3035 ctatgcttcgatctgcatgttccaagtca 3007



to top

>dbj|AK063966.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-124-A04, full
            insert sequence
          Length = 3193

 Score = 42.1 bits (21), Expect = 0.83
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 225  ctatgcttcgatgtgcatgttccatgtca 253
            |||||||||||| ||||||||||| ||||
Sbjct: 3034 ctatgcttcgatctgcatgttccaagtca 3006



to top

>gb|CP000025.1| Campylobacter jejuni RM1221, complete genome
          Length = 1777831

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 129    tttaagctctataaatttaa 148
              ||||||||||||||||||||
Sbjct: 798940 tttaagctctataaatttaa 798959



to top

>gb|AF381694.1| Uncultured chlorophyte clone 994AY17 ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds
          Length = 588

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 26  caagactgagcttcaatgggtgga 49
           |||||||| |||||||||||||||
Sbjct: 541 caagactgggcttcaatgggtgga 564



to top

>gb|AF381698.1| Uncultured chlorophyte clone 994AY7 ribulose 1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds
          Length = 588

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 26  caagactgagcttcaatgggtgga 49
           |||||||| |||||||||||||||
Sbjct: 538 caagactgggcttcaatgggtgga 561



to top

>gb|CP000053.1| Rickettsia felis URRWXCal2, complete genome
          Length = 1485148

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 125     actttttaagctctataaat 144
               ||||||||||||||||||||
Sbjct: 1103611 actttttaagctctataaat 1103630



to top

>emb|AL160010.14| Human DNA sequence from clone RP11-146P20 on chromosome 10 Contains
             part of the gene for VPS10 domain receptor protein SORCS
             1, complete sequence
          Length = 158724

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   catgcagacggaagcagagg 205
             ||||||||||||||||||||
Sbjct: 93875 catgcagacggaagcagagg 93894



to top

>emb|AL139076.2|CJ11168X3 Campylobacter jejuni subsp. jejuni NCTC 11168 complete genome; segment
             3/6
          Length = 317511

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 129   tttaagctctataaatttaa 148
             ||||||||||||||||||||
Sbjct: 97835 tttaagctctataaatttaa 97854



to top

>emb|BX901956.4| Zebrafish DNA sequence from clone CH211-284C12 in linkage group 3,
              complete sequence
          Length = 197042

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 50     tcagagttcacaaatggtgt 69
              ||||||||||||||||||||
Sbjct: 168687 tcagagttcacaaatggtgt 168668



to top

>gb|AC097061.2| Homo sapiens chromosome 1 clone RP11-415L24, complete sequence
          Length = 165311

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 187   atgcagacggaagcagaggc 206
             ||||||||||||||||||||
Sbjct: 90987 atgcagacggaagcagaggc 90968



to top

>gb|AC018793.12| Homo sapiens chromosome 11, clone RP11-437G21, complete sequence
          Length = 202956

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 197   aagcagaggcaaatgcagct 216
             ||||||||||||||||||||
Sbjct: 99826 aagcagaggcaaatgcagct 99807



to top

>gb|AY232508.1| Donacia japana isolate N264 cytochrome oxidase subunit I gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 750

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 128 ttttaagctctataaattta 147
           ||||||||||||||||||||
Sbjct: 645 ttttaagctctataaattta 664



to top

>gb|AY232507.1| Donacia japana isolate N119 cytochrome oxidase subunit I gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 750

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 128 ttttaagctctataaattta 147
           ||||||||||||||||||||
Sbjct: 645 ttttaagctctataaattta 664



to top

>gb|AY232506.1| Donacia japana isolate N79 cytochrome oxidase subunit I gene,
           partial cds; mitochondrial gene for mitochondrial
           product
          Length = 750

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 128 ttttaagctctataaattta 147
           ||||||||||||||||||||
Sbjct: 645 ttttaagctctataaattta 664



to top

>gb|AY157477.1| Uncultured marine eukaryote clone T7ASY6 ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; plastid gene for plastid product
          Length = 582

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 26  caagactgagcttcaatgggtgga 49
           |||||||| |||||||||||||||
Sbjct: 535 caagactgggcttcaatgggtgga 558



to top

>gb|AY157468.1| Uncultured marine eukaryote clone T5SY4 ribulose-1,5-bisphosphate
           carboxylase/oxygenase large subunit (rbcL) gene, partial
           cds; plastid gene for plastid product
          Length = 586

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 26  caagactgagcttcaatgggtgga 49
           |||||||| |||||||||||||||
Sbjct: 539 caagactgggcttcaatgggtgga 562



to top

>gb|AC010894.10| Homo sapiens BAC clone RP11-483E17 from 2, complete sequence
          Length = 181663

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 133    agctctataaatttaaatta 152
              ||||||||||||||||||||
Sbjct: 175855 agctctataaatttaaatta 175836



to top

>dbj|AB005236.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MIK22
          Length = 82035

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   tactttttaagctctataaa 143
             ||||||||||||||||||||
Sbjct: 24387 tactttttaagctctataaa 24368



to top

>ref|XM_315898.2| Anopheles gambiae str. PEST ENSANGP00000004512 (ENSANGG00000003543),
            partial mRNA
          Length = 3441

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 158  gacgacgacgagtcgaacga 177
            ||||||||||||||||||||
Sbjct: 1237 gacgacgacgagtcgaacga 1256



to top

>emb|AL935200.9| Zebrafish DNA sequence from clone CH211-237I5, complete sequence
          Length = 160710

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    tcagagttcacaaatggtgt 69
             ||||||||||||||||||||
Sbjct: 56194 tcagagttcacaaatggtgt 56213


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,279,154
Number of Sequences: 3902068
Number of extensions: 2279154
Number of successful extensions: 44687
Number of sequences better than 10.0: 24
Number of HSP's better than 10.0 without gapping: 24
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44590
Number of HSP's gapped (non-prelim): 97
length of query: 253
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 231
effective length of database: 17,147,199,772
effective search space: 3961003147332
effective search space used: 3961003147332
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top