>gb|AC132954.4| Mus musculus BAC clone RP24-210F23 from 12, complete sequence
          Length = 160118

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 296   gaaccatttccttttgccttg 316
             |||||||||||||||||||||
Sbjct: 85929 gaaccatttccttttgccttg 85949

>gb|AC010921.12| Drosophila melanogaster clone BACR15L12, complete sequence
          Length = 163466

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 61    cggctcagcagtggaaagta 80
             ||||||||||||||||||||
Sbjct: 62283 cggctcagcagtggaaagta 62264

>gb|AC012160.7| Drosophila melanogaster clone BACR06G02, complete sequence
          Length = 172069

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 61    cggctcagcagtggaaagta 80
             ||||||||||||||||||||
Sbjct: 41423 cggctcagcagtggaaagta 41442

>gb|AC121906.3| Mus musculus BAC clone RP24-176E21 from chromosome 3, complete sequence
          Length = 171059

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 290   tctcttgaaccatttccttttgcc 313
             ||||||||||||||||||| ||||
Sbjct: 71165 tctcttgaaccatttccttgtgcc 71142

>emb|AL590448.1|CNS07EGF chromosome VIII of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 238147

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 97     ctaaaacacttgaccagata 116
              ||||||||||||||||||||
Sbjct: 224012 ctaaaacacttgaccagata 224031

>emb|BX936335.6| Zebrafish DNA sequence from clone CH211-287C12 in linkage group 3,
            complete sequence
          Length = 62086

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 173  taatacgtacaacatgatga 192
            ||||||||||||||||||||
Sbjct: 8861 taatacgtacaacatgatga 8842

>gb|AC022016.7| Homo sapiens chromosome 10 clone RP11-165M8, complete sequence
          Length = 163031

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 53    tatgtccacggctcagcagtggaa 76
             |||||||| |||||||||||||||
Sbjct: 55535 tatgtccagggctcagcagtggaa 55558

>ref|NG_004788.1| Homo sapiens cofilin pseudogene 1 (CFLP1) on chromosome 10
          Length = 26979

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 53    tatgtccacggctcagcagtggaa 76
             |||||||| |||||||||||||||
Sbjct: 19501 tatgtccagggctcagcagtggaa 19524

>ref|NM_031320.1| Rattus norvegicus cadherin EGF LAG seven-pass G-type receptor 3
            (Celsr3), mRNA
          Length = 11868

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 104  acttgaccagatacaagctctaga 127
            |||||||||| |||||||||||||
Sbjct: 4977 acttgaccagctacaagctctaga 4954

>gb|AC008179.2| Homo sapiens BAC clone RP11-576F1 from 2, complete sequence
          Length = 181745

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 1      aaatcaagacatgaaaagac 20
              ||||||||||||||||||||
Sbjct: 117240 aaatcaagacatgaaaagac 117221

>gb|AE003504.4| Drosophila melanogaster chromosome X, section 56 of 74 of the complete
              sequence
          Length = 298703

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 61     cggctcagcagtggaaagta 80
              ||||||||||||||||||||
Sbjct: 171640 cggctcagcagtggaaagta 171659

>dbj|AB011528.1| Rattus norvegicus mRNA for MEGF2, complete cds
          Length = 11868

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 104  acttgaccagatacaagctctaga 127
            |||||||||| |||||||||||||
Sbjct: 4977 acttgaccagctacaagctctaga 4954


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,773,508
Number of Sequences: 3902068
Number of extensions: 2773508
Number of successful extensions: 51893
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51878
Number of HSP's gapped (non-prelim): 15
length of query: 353
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 331
effective length of database: 17,147,199,772
effective search space: 5675723124532
effective search space used: 5675723124532
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)