ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl14a06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY494984.1| Triticum aestivum LON1 protease mRNA, complete cds 523 e-145
2gb|DQ257593.1| Hordeum vulgare subsp. vulgare clone 29-26A-LB fl... 50 0.006
3gb|DQ175915.1| Hordeum vulgare subsp. vulgare clone 29-26A-LB fl... 50 0.006
4dbj|AB182945.1| Triticum aestivum Wknox1d gene for KN1 homeobox ... 48 0.024
5gb|AC113269.13| Mus musculus chromosome 15, clone RP23-372F2, co... 42 1.5
6gb|AF325198.1|AF325198 Triticum aestivum LRR14 (Lrr14), TAK14 (T... 42 1.5
7gb|AC140791.4| Gallus gallus BAC clone TAM33-20G4 from chromosom... 42 1.5
8dbj|AP004913.1| Lotus japonicus genomic DNA, chromosome 5, clone... 42 1.5
9gb|AE000665.1|MMAE000665 Mus musculus TCR beta locus from bases ... 40 5.8
10gb|AC117678.16| Mus musculus chromosome 6, clone RP23-421M9, com... 40 5.8
11emb|CR962127.1| Medicago truncatula chromosome 5 clone mth2-181n... 40 5.8
12gb|AC133571.47| Medicago truncatula clone mth2-10h12, complete s... 40 5.8
13gb|AF336378.1| Mus musculus Kel blood group protein (Kel), epith... 40 5.8
14dbj|AB182943.1| Triticum aestivum Wknox1a gene for KN1 homeobox ... 40 5.8
15gb|AC004827.1|AC004827 Homo sapiens PAC clone RP1-44L15 from Xq2... 40 5.8
16emb|CT573053.1| Medicago truncatula chromosome 5 clone mte1-8e5,... 40 5.8

>gb|AY494984.1| Triticum aestivum LON1 protease mRNA, complete cds
          Length = 3143

 Score =  523 bits (264), Expect = e-145
 Identities = 329/348 (94%), Gaps = 2/348 (0%)
 Strand = Plus / Minus

                                                                        
Query: 87   atgatactgcaacattcaattctccctggctgaaataggttacatatacacccaaaccga 146
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3103 atgatactgcaacattcaattctccctggctgaaataggttacatatacacccaaaccga 3044

                                                                        
Query: 147  caacaacaggtggatctccttgctaccaataccaaaccgagcatagatagatgagcatcc 206
            |||||||||||||| ||||||||||||| || ||||||||||||||||||||||||||||
Sbjct: 3043 caacaacaggtggacctccttgctacca-tagcaaaccgagcatagatagatgagcatcc 2985

                                                                        
Query: 207  ctctataaatacaagcacaaagaccggagcagatctccctgccgcttttgtggatagcaa 266
            |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 2984 ctctataaatacaatcacaaagaccagagcagatctccctgccgcttttgtggatagcaa 2925

                                                                        
Query: 267  gtacccatatacacattccgcatattagcttaactgaattggacgagcgatgctggcgtc 326
            ||| ||||||||||||||||||||||||||||||||| |||||||||| | |||||||||
Sbjct: 2924 gtatccatatacacattccgcatattagcttaactgagttggacgagcaacgctggcgtc 2865

                                                                        
Query: 327  atgagatttcactccgatggagcaattgctcgcctacgctcagtcgctcgtttgtagata 386
            |||||||||| |||| | ||||||||||||||||||||||||  ||||| ||||||||||
Sbjct: 2864 atgagatttcgctccaacggagcaattgctcgcctacgctca-acgctcatttgtagata 2806

                                                            
Query: 387  tctgggcagtgaatagcgacgaatcttcaaaacaggtacatggccacc 434
            ||||||| |||||||||||||||||||||||||  ||| |||||||||
Sbjct: 2805 tctgggcggtgaatagcgacgaatcttcaaaacgagtaaatggccacc 2758



to top

>gb|DQ257593.1| Hordeum vulgare subsp. vulgare clone 29-26A-LB flanking T-DNA
           insertion sequence
          Length = 623

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 9   gatgtatatagacacgtcttagcgtgtttgttcactc 45
           ||||||||||||||||| |||| | ||||||||||||
Sbjct: 350 gatgtatatagacacgttttagtgcgtttgttcactc 314



to top

>gb|DQ175915.1| Hordeum vulgare subsp. vulgare clone 29-26A-LB flanking T-DNA
           insertion sequence
          Length = 664

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 9   gatgtatatagacacgtcttagcgtgtttgttcactc 45
           ||||||||||||||||| |||| | ||||||||||||
Sbjct: 274 gatgtatatagacacgttttagtgcgtttgttcactc 310



to top

>dbj|AB182945.1| Triticum aestivum Wknox1d gene for KN1 homeobox protein, complete cds
          Length = 9086

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 2    tgaatcggatgtatatagacacgtcttagcgtgtttgttcactc 45
            |||||| ||||||||||||||| | | || ||||||||||||||
Sbjct: 7925 tgaatcagatgtatatagacacatttgagtgtgtttgttcactc 7968



to top

>gb|AC113269.13| Mus musculus chromosome 15, clone RP23-372F2, complete sequence
          Length = 202155

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 92    actgcaacattcaattctccc 112
             |||||||||||||||||||||
Sbjct: 80340 actgcaacattcaattctccc 80320



to top

>gb|AF325198.1|AF325198 Triticum aestivum LRR14 (Lrr14), TAK14 (TAK14), and LRK14 (Lrk14)
             genes, complete cds; and unknown gene
          Length = 43606

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 40/45 (88%), Gaps = 1/45 (2%)
 Strand = Plus / Plus

                                                          
Query: 1     ctgaatcggatgtatatagacacgtcttagcgtgtttgttcactc 45
             |||| |||||||||||||||| | | |||| ||||||||||||||
Sbjct: 40316 ctgattcggatgtatatagacgcattttag-gtgtttgttcactc 40359



to top

>gb|AC140791.4| Gallus gallus BAC clone TAM33-20G4 from chromosome ul, complete
            sequence
          Length = 219854

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 189  atagatagatgagcatccctc 209
            |||||||||||||||||||||
Sbjct: 6522 atagatagatgagcatccctc 6502



to top

>dbj|AP004913.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT02A14, TM0072a,
            complete sequence
          Length = 100740

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 275  atacacattccgcatattagcttaa 299
            |||||||||||||||||||| ||||
Sbjct: 4022 atacacattccgcatattagattaa 4046



to top

>gb|AE000665.1|MMAE000665 Mus musculus TCR beta locus from bases 501860 to 700960 (section 3 of 3)
              of the complete sequence
          Length = 199101

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 250    gcttttgtggatagcaagta 269
              ||||||||||||||||||||
Sbjct: 194392 gcttttgtggatagcaagta 194373



to top

>gb|AC117678.16| Mus musculus chromosome 6, clone RP23-421M9, complete sequence
          Length = 204437

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 250   gcttttgtggatagcaagta 269
             ||||||||||||||||||||
Sbjct: 96556 gcttttgtggatagcaagta 96537



to top

>emb|CR962127.1| Medicago truncatula chromosome 5 clone mth2-181n9, COMPLETE SEQUENCE
          Length = 119528

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 206  cctctataaatacaagcaca 225
            ||||||||||||||||||||
Sbjct: 9634 cctctataaatacaagcaca 9615



to top

>gb|AC133571.47| Medicago truncatula clone mth2-10h12, complete sequence
          Length = 85905

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   cctctataaatacaagcaca 225
             ||||||||||||||||||||
Sbjct: 64740 cctctataaatacaagcaca 64759



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   cctctataaatacaagcaca 225
             ||||||||||||||||||||
Sbjct: 55200 cctctataaatacaagcaca 55219



to top

>gb|AF336378.1| Mus musculus Kel blood group protein (Kel), epithelial calcium channel 1
              (Ecac1), epithelial calcium channel 2 (Ecac2), and ephrin
              type A receptor (Mep) genes, complete cds; and T cell
              receptor beta chain (Tcr) gene, partial cds
          Length = 169781

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 250    gcttttgtggatagcaagta 269
              ||||||||||||||||||||
Sbjct: 142129 gcttttgtggatagcaagta 142148



to top

>dbj|AB182943.1| Triticum aestivum Wknox1a gene for KN1 homeobox protein, complete cds
          Length = 9755

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                
Query: 8    ggatgtatatagacacgtcttagcgtgtttgttcac 43
            |||||||||||| || || |||| ||||||||||||
Sbjct: 8612 ggatgtatataggcatgttttagtgtgtttgttcac 8647



to top

>gb|AC004827.1|AC004827 Homo sapiens PAC clone RP1-44L15 from Xq23, complete sequence
          Length = 129690

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 31    cgtgtttgttcactctatat 50
             ||||||||||||||||||||
Sbjct: 24961 cgtgtttgttcactctatat 24980



to top

>emb|CT573053.1| Medicago truncatula chromosome 5 clone mte1-8e5, COMPLETE SEQUENCE
          Length = 106640

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 206    cctctataaatacaagcaca 225
              ||||||||||||||||||||
Sbjct: 105678 cctctataaatacaagcaca 105659



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   cctctataaatacaagcaca 225
             ||||||||||||||||||||
Sbjct: 96032 cctctataaatacaagcaca 96013


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,965,412
Number of Sequences: 3902068
Number of extensions: 2965412
Number of successful extensions: 42203
Number of sequences better than 10.0: 17
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 42179
Number of HSP's gapped (non-prelim): 22
length of query: 434
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 412
effective length of database: 17,147,199,772
effective search space: 7064646306064
effective search space used: 7064646306064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top