ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl13h02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_626340.1| Cryptosporidium parvum Iowa II hypothetical pro... 46 0.060
2gb|AC040171.4| Homo sapiens chromosome 16 clone RP11-52D13, comp... 44 0.24
3emb|AL773538.7| Mouse DNA sequence from clone RP23-14I24 on chro... 42 0.93
4gb|AC159238.2| Mus musculus BAC clone RP24-477O8 from chromosome... 40 3.7
5gb|AC121235.20| Medicago truncatula clone mth2-21k24, complete s... 40 3.7
6gb|AC151740.21| Medicago truncatula clone mth2-82n16, complete s... 40 3.7
7emb|BX908776.14| Zebrafish DNA sequence from clone DKEY-88E12 in... 40 3.7
8gb|AC107626.2| Homo sapiens chromosome 3 clone RP11-1008M1, comp... 40 3.7
9emb|AL929327.5| Zebrafish DNA sequence from clone CH211-151O20, ... 40 3.7
10dbj|AB019232.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 3.7
11gb|AE014299.1| Shewanella oneidensis MR-1, complete genome 40 3.7

>ref|XM_626340.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd2_1130),
           partial mRNA
          Length = 2046

 Score = 46.1 bits (23), Expect = 0.060
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 68  agctaattatctcaaatacattacaac 94
           |||||||||||||||||||||| ||||
Sbjct: 923 agctaattatctcaaatacatttcaac 949



to top

>gb|AC040171.4| Homo sapiens chromosome 16 clone RP11-52D13, complete sequence
          Length = 151368

 Score = 44.1 bits (22), Expect = 0.24
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 109   tacatgacaacatgtgatatacaaat 134
             ||||||||||||||||||| ||||||
Sbjct: 89296 tacatgacaacatgtgatagacaaat 89271



to top

>emb|AL773538.7| Mouse DNA sequence from clone RP23-14I24 on chromosome 2, complete
             sequence
          Length = 178544

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 244   gtaagttgtaactattaaata 264
             |||||||||||||||||||||
Sbjct: 32643 gtaagttgtaactattaaata 32663



to top

>gb|AC159238.2| Mus musculus BAC clone RP24-477O8 from chromosome 12, complete sequence
          Length = 176407

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 208    ttgatcatatatgctgactg 227
              ||||||||||||||||||||
Sbjct: 127799 ttgatcatatatgctgactg 127818



to top

>gb|AC121235.20| Medicago truncatula clone mth2-21k24, complete sequence
          Length = 116205

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    tcaaatacattacaacctag 98
             ||||||||||||||||||||
Sbjct: 29046 tcaaatacattacaacctag 29065



to top

>gb|AC151740.21| Medicago truncatula clone mth2-82n16, complete sequence
          Length = 131700

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 51    caagttcatgtatgaacagc 70
             ||||||||||||||||||||
Sbjct: 72067 caagttcatgtatgaacagc 72086



to top

>emb|BX908776.14| Zebrafish DNA sequence from clone DKEY-88E12 in linkage group 3, complete
              sequence
          Length = 249946

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 84     tacattacaacctagaacat 103
              ||||||||||||||||||||
Sbjct: 154372 tacattacaacctagaacat 154391



to top

>gb|AC107626.2| Homo sapiens chromosome 3 clone RP11-1008M1, complete sequence
          Length = 179484

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 53     agttcatgtatgaacagcta 72
              ||||||||||||||||||||
Sbjct: 161081 agttcatgtatgaacagcta 161100



to top

>emb|AL929327.5| Zebrafish DNA sequence from clone CH211-151O20, complete sequence
          Length = 145366

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    tacattacaacctagaacat 103
             ||||||||||||||||||||
Sbjct: 80096 tacattacaacctagaacat 80115



to top

>dbj|AB019232.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIL23
          Length = 80818

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 235   aataccctcgtaagttgtaactat 258
             |||||||| |||||||||||||||
Sbjct: 63492 aatacccttgtaagttgtaactat 63515



to top

>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome
          Length = 4969803

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 2      aaaataactaaagcgatttt 21
              ||||||||||||||||||||
Sbjct: 343794 aaaataactaaagcgatttt 343813


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,280,330
Number of Sequences: 3902068
Number of extensions: 2280330
Number of successful extensions: 43717
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43684
Number of HSP's gapped (non-prelim): 33
length of query: 283
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 261
effective length of database: 17,147,199,772
effective search space: 4475419140492
effective search space used: 4475419140492
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top