>gb|AC161766.2| Mus musculus BAC clone RP23-39O12 from chromosome 12, complete sequence
          Length = 224641

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 111    taagtagacaatttactagttt 132
              ||||||||||||||||||||||
Sbjct: 217131 taagtagacaatttactagttt 217152

>gb|AC090677.13| Homo sapiens 12 BAC RP11-637N6 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 60429

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 144  atagattttggaatattttattccat 169
            ||||||||||||||||| ||||||||
Sbjct: 5118 atagattttggaatattatattccat 5143

>gb|AY104777.1| Zea mays PCO062010 mRNA sequence
          Length = 1069

 Score = 44.1 bits (22), Expect = 0.25
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 87  actaacaagtagtacaactcat 108
           ||||||||||||||||||||||
Sbjct: 952 actaacaagtagtacaactcat 931

>gb|AC064868.5| Homo sapiens BAC clone RP11-473E10 from 2, complete sequence
          Length = 178181

 Score = 42.1 bits (21), Expect = 0.97
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 143   aatagattttggaatatttta 163
             |||||||||||||||||||||
Sbjct: 16846 aatagattttggaatatttta 16866

>ref|XM_415886.1| PREDICTED: Gallus gallus similar to KIAA1287 protein (LOC417641),
           mRNA
          Length = 1965

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 151 ttggaatattttattccatc 170
           ||||||||||||||||||||
Sbjct: 920 ttggaatattttattccatc 901

>ref|NM_001030722.1| Gallus gallus integrator complex subunit 2 (INTS2), mRNA
          Length = 5076

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 151  ttggaatattttattccatc 170
            ||||||||||||||||||||
Sbjct: 4025 ttggaatattttattccatc 4006

>ref|XM_958751.1| Neurospora crassa OR74A hypothetical protein (NCU02751.1) partial
            mRNA
          Length = 3477

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 24   ttttcgtttgacttatctct 43
            ||||||||||||||||||||
Sbjct: 2639 ttttcgtttgacttatctct 2620

>ref|XM_331949.1| Neurospora crassa OR74A hypothetical protein (NCU02751.1) partial
            mRNA
          Length = 3477

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 24   ttttcgtttgacttatctct 43
            ||||||||||||||||||||
Sbjct: 2639 ttttcgtttgacttatctct 2620

>emb|AJ719990.1| Gallus gallus mRNA for hypothetical protein, clone 9c3
          Length = 5076

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 151  ttggaatattttattccatc 170
            ||||||||||||||||||||
Sbjct: 4025 ttggaatattttattccatc 4006

>emb|CR522900.1| Gallus gallus finished cDNA, clone ChEST396a11
          Length = 999

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 151 ttggaatattttattccatc 170
           ||||||||||||||||||||
Sbjct: 406 ttggaatattttattccatc 387

>gb|AC157791.6| Mus musculus chromosome 3, clone RP24-176D22, complete sequence
          Length = 179897

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 145    tagattttggaatattttat 164
              ||||||||||||||||||||
Sbjct: 120677 tagattttggaatattttat 120696

>gb|AC087330.6| Mus Musculus Strain C57BL6/J chromosome 5 BAC, RP23-3M10, complete
              sequence
          Length = 206093

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 192    ttattgtttcttgcctgtttgtct 215
              |||||||| |||||||||||||||
Sbjct: 133425 ttattgttacttgcctgtttgtct 133448

>gb|AC026191.4| Homo sapiens chromosome 3 clone RP11-380O24 map 3p, complete sequence
          Length = 164528

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 137    tgctctaatagattttggaa 156
              ||||||||||||||||||||
Sbjct: 143927 tgctctaatagattttggaa 143946


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,025,766
Number of Sequences: 3902068
Number of extensions: 3025766
Number of successful extensions: 63463
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63446
Number of HSP's gapped (non-prelim): 17
length of query: 293
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 271
effective length of database: 17,147,199,772
effective search space: 4646891138212
effective search space used: 4646891138212
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)