>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 278      catgatatcattaccactttat 299
                ||||||||||||||||||||||
Sbjct: 16841500 catgatatcattaccactttat 16841521

>dbj|AP005817.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1118_F01
          Length = 119248

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 278   catgatatcattaccactttat 299
             ||||||||||||||||||||||
Sbjct: 54865 catgatatcattaccactttat 54886

>emb|AL157836.11| Human DNA sequence from clone RP11-477D14 on chromosome 10, complete
             sequence
          Length = 175382

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 168   ttgaaatgaccaggaaacaga 188
             |||||||||||||||||||||
Sbjct: 11784 ttgaaatgaccaggaaacaga 11764

>emb|AL035468.3|HS424E5 Human DNA sequence from clone RP3-424E5 on chromosome 6q13-14.3,
             complete sequence
          Length = 93805

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 271   acaaccacatgatatcattac 291
             |||||||||||||||||||||
Sbjct: 55914 acaaccacatgatatcattac 55934

>gb|AC150532.2| Bos taurus  BAC CH240-105A12 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 186851

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 111    caattttgattccatcttgt 130
              ||||||||||||||||||||
Sbjct: 176981 caattttgattccatcttgt 177000

>gb|AC149716.2| Bos taurus  BAC CH240-31B10 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 171707

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 111    caattttgattccatcttgt 130
              ||||||||||||||||||||
Sbjct: 104441 caattttgattccatcttgt 104422

>gb|AC151956.5| Medicago truncatula clone mth2-52p17, complete sequence
          Length = 120704

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 219   gagtcaaaaattggatagag 238
             ||||||||||||||||||||
Sbjct: 25025 gagtcaaaaattggatagag 25044

>gb|AC023136.6| Homo sapiens BAC clone RP11-497K21 from 4, complete sequence
          Length = 185593

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 271  acaaccacatgatatcatta 290
            ||||||||||||||||||||
Sbjct: 5129 acaaccacatgatatcatta 5110

>gb|AC015921.20| Homo sapiens chromosome 17, clone CTD-3060P21, complete sequence
          Length = 140386

 Score = 40.1 bits (20), Expect = 4.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 8     aaataaaataggtcatttcc 27
             ||||||||||||||||||||
Sbjct: 19715 aaataaaataggtcatttcc 19734


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,167,038
Number of Sequences: 3902068
Number of extensions: 3167038
Number of successful extensions: 56121
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 56093
Number of HSP's gapped (non-prelim): 28
length of query: 304
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 282
effective length of database: 17,147,199,772
effective search space: 4835510335704
effective search space used: 4835510335704
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)