ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl13c12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL008970.3|PFMAL3P4 Plasmodium falciparum MAL3P4 42 0.25
2dbj|AB190356.1| Brassica oleracea BoSP11-28 gene, complete cds 42 0.25
3gb|AC129959.6| Bos taurus, clone RP42-518P7, complete sequence 42 0.25
4gb|AC147972.3| Gallus gallus BAC clone CH261-78M4 from chromosom... 42 0.25
5gb|AC136699.23| Mus musculus chromosome 9, clone RP23-18E24, com... 40 0.98
6gb|AC125133.2| Mus musculus BAC clone RP24-316A22 from chromosom... 40 0.98
7gb|AF077529.1| Caenorhabditis elegans cosmid C09E8, complete seq... 40 0.98
8gb|AE014824.1| Plasmodium falciparum 3D7 chromosome 14 section 9... 40 0.98
9emb|AL161548.2|ATCHRIV48 Arabidopsis thaliana DNA chromosome 4, ... 40 0.98
10emb|AL021710.1|ATF28J12 Arabidopsis thaliana DNA chromosome 4, B... 40 0.98
11emb|AL021713.1|ATT9A21 Arabidopsis thaliana DNA chromosome 4, BA... 40 0.98
12gb|AC003684.1| Homo sapiens X BAC GS1-519E5 (Genome Systems Huma... 40 0.98
13emb|AL732452.5| Mouse DNA sequence from clone RP23-177C20 on chr... 40 0.98
14emb|AL928876.12| Mouse DNA sequence from clone RP23-236O6 on chr... 40 0.98
15gb|AC112265.5| Mus musculus BAC clone RP23-421N20 from 10, compl... 40 0.98
16gb|AC110904.8| Mus musculus chromosome 7, clone RP24-174I24, com... 38 3.9
17ref|XM_950667.1| Neurospora crassa OR74A hypothetical protein (N... 38 3.9
18gb|AC116774.9| Mus musculus chromosome 3, clone RP24-361N19, com... 38 3.9
19gb|AC185988.2| Pan troglodytes BAC clone CH251-398L15 from chrom... 38 3.9
20ref|XM_322679.1| Neurospora crassa OR74A predicted protein (NCU0... 38 3.9
21gb|AC140311.2| Mus musculus BAC clone RP23-392M3 from chromosome... 38 3.9
22gb|AC162901.4| Mus musculus BAC clone RP23-417K5 from chromosome... 38 3.9
23gb|AC184157.2| Pan troglodytes BAC clone CH251-31B9 from chromos... 38 3.9
24gb|AC184054.2| Pan troglodytes BAC clone CH251-706J5 from chromo... 38 3.9
25gb|AC147344.2| Pan troglodytes BAC clone CH251-4O16 from Y, comp... 38 3.9
26gb|AC122416.4| Mus musculus BAC clone RP24-157E17 from chromosom... 38 3.9
27gb|AC115119.5| Mus musculus BAC clone RP23-87M19 from 18, comple... 38 3.9
28emb|CR848676.7| Zebrafish DNA sequence from clone DKEY-265I7 in ... 38 3.9
29gb|AC146206.3| Pan troglodytes BAC clone CH251-395K13 from Y, co... 38 3.9
30gb|AY371488.1| Zea mays clone BAC 276N12-123C01, partial sequence 38 3.9
31ref|XM_669732.1| Plasmodium berghei strain ANKA hypothetical pro... 38 3.9
32gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequ... 38 3.9
33emb|AL355504.17| Human DNA sequence from clone RP11-218A18 on ch... 38 3.9
34emb|AL353623.16| Human DNA sequence from clone RP11-376H15 on ch... 38 3.9
35emb|AL031650.22|HS1018D12 Human DNA sequence from clone RP5-1018... 38 3.9
36emb|AL031903.2|HS1032F13 Human DNA sequence from clone RP5-1032F... 38 3.9
37emb|Z92540.1|HS179I15A Human DNA sequence from clone RP1-179I15 ... 38 3.9
38emb|Z26877.1|SCDCHR11 S.cerevisiae (S288C) 36.2kb DNA fragment f... 38 3.9
39emb|AL669991.1|NCB11B23 Neurospora crassa DNA linkage group II B... 38 3.9
40gb|AC007051.3| Homo sapiens chromosome 3, clone hRPK.44_A_1, com... 38 3.9
41dbj|BS000553.1| Pan troglodytes chromosome Y clone:PTB-310C12, c... 38 3.9
42emb|BX276108.6| Zebrafish DNA sequence from clone CH211-265M17 i... 38 3.9
43gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 38 3.9
44gb|AC182493.3| Pan troglodytes BAC clone CH251-215H7 from chromo... 38 3.9
45gb|AC021642.14| Mus musculus chromosome 10 clone RP23-113O5, co... 38 3.9
46gb|AC016938.24| Homo sapiens 3 BAC RP11-196F13 (Roswell Park Can... 38 3.9
47gb|AC026884.7| Homo sapiens chromosome 10 clone RP11-123G9, comp... 38 3.9
48gb|AC104136.5| Homo sapiens BAC clone RP11-782E2 from 4, complet... 38 3.9
49gb|AY071587.1| Drosophila melanogaster RE64145 full length cDNA 38 3.9
50gb|AC024569.5| Homo sapiens chromosome 5 clone CTD-2188H20, comp... 38 3.9
51gb|AC020977.6| Homo sapiens chromosome 5 clone RP11-92M7, comple... 38 3.9
52emb|BX248323.8| Zebrafish DNA sequence from clone CH211-199J6, c... 38 3.9
53gb|AC158653.7| Mus musculus 6 BAC RP23-418F10 (Roswell Park Canc... 38 3.9
54gb|AY913763.1| Pan troglodytes ZFY (ZFY) gene, complete cds 38 3.9
55gb|AC008901.5|AC008901 Homo sapiens chromosome 5 clone CTD-2245E... 38 3.9
56gb|AC007559.3| Homo sapiens BAC clone RP11-364J6 from 2, complet... 38 3.9
57gb|AC013412.3|AC013412 Homo sapiens BAC clone RP11-507A3 from Y,... 38 3.9
58emb|AJ330214.1|HSA330214 Homo sapiens genomic sequence surroundi... 38 3.9
59emb|CR381692.13| Zebrafish DNA sequence from clone CH211-242K1 i... 38 3.9
60gb|AC149381.2| Phakopsora pachyrhizi clone JGIAFNA-5A7, complete... 38 3.9
61emb|BX537305.32| Zebrafish DNA sequence from clone DKEY-45L12, c... 38 3.9
62emb|Z28156.1|SCYKL156W S.cerevisiae chromosome XI reading frame ... 38 3.9
63emb|Z28155.1|SCYKL155C S.cerevisiae chromosome XI reading frame ... 38 3.9
64emb|AL928598.7| Mouse DNA sequence from clone RP23-326I20 on chr... 38 3.9
65gb|AC124491.5| Mus musculus BAC clone RP23-454B2 from chromosome... 38 3.9
66gb|AC134623.5| Mus musculus BAC clone RP23-20K21 from 8, complet... 38 3.9
67gb|AC132137.3| Mus musculus BAC clone RP23-153E2 from 3, complet... 38 3.9
68emb|AL807236.11| Mouse DNA sequence from clone RP23-219O14 on ch... 38 3.9
69dbj|AP005117.2| Homo sapiens genomic DNA, chromosome 18p clone:R... 38 3.9 
>emb|AL008970.3|PFMAL3P4 Plasmodium falciparum MAL3P4
          Length = 113880

 Score = 42.1 bits (21), Expect = 0.25
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 44    atatatattcaatactttaat 64
             |||||||||||||||||||||
Sbjct: 68075 atatatattcaatactttaat 68055
to top
>dbj|AB190356.1| Brassica oleracea BoSP11-28 gene, complete cds
          Length = 4522

 Score = 42.1 bits (21), Expect = 0.25
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 32   ttttatgcataaatatatatt 52
            |||||||||||||||||||||
Sbjct: 1160 ttttatgcataaatatatatt 1140
to top
>gb|AC129959.6| Bos taurus, clone RP42-518P7, complete sequence
          Length = 211988

 Score = 42.1 bits (21), Expect = 0.25
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 41     taaatatatattcaatacttt 61
              |||||||||||||||||||||
Sbjct: 194539 taaatatatattcaatacttt 194559
to top
>gb|AC147972.3| Gallus gallus BAC clone CH261-78M4 from chromosome unknown, complete
              sequence
          Length = 197959

 Score = 42.1 bits (21), Expect = 0.25
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 31     tttttatgcataaatatatat 51
              |||||||||||||||||||||
Sbjct: 172186 tttttatgcataaatatatat 172206
to top
>gb|AC136699.23| Mus musculus chromosome 9, clone RP23-18E24, complete sequence
          Length = 229184

 Score = 40.1 bits (20), Expect = 0.98
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 36     atgcataaatatatattcaatactttaa 63
              ||||||||||||||||| |||| |||||
Sbjct: 155106 atgcataaatatatatttaataatttaa 155133
to top
>gb|AC125133.2| Mus musculus BAC clone RP24-316A22 from chromosome 18, complete
             sequence
          Length = 175583

 Score = 40.1 bits (20), Expect = 0.98
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    taaatatatattcaatactt 60
             ||||||||||||||||||||
Sbjct: 97142 taaatatatattcaatactt 97161
to top
>gb|AF077529.1| Caenorhabditis elegans cosmid C09E8, complete sequence
          Length = 21615

 Score = 40.1 bits (20), Expect = 0.98
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 30    ctttttatgcataaatatatattc 53
             |||||||| |||||||||||||||
Sbjct: 13226 ctttttatacataaatatatattc 13249
to top
>gb|AE014824.1| Plasmodium falciparum 3D7 chromosome 14 section 9 of 13 of the complete
              sequence
          Length = 250022

 Score = 40.1 bits (20), Expect = 0.98
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 33     tttatgcataaatatatatt 52
              ||||||||||||||||||||
Sbjct: 235451 tttatgcataaatatatatt 235432



 Score = 40.1 bits (20), Expect = 0.98
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 33     tttatgcataaatatatatt 52
              ||||||||||||||||||||
Sbjct: 184775 tttatgcataaatatatatt 184794
to top
>emb|AL161548.2|ATCHRIV48 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 48
          Length = 194143

 Score = 40.1 bits (20), Expect = 0.98
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     taaatatatattcaatactt 60
              ||||||||||||||||||||
Sbjct: 108047 taaatatatattcaatactt 108066
to top
>emb|AL021710.1|ATF28J12 Arabidopsis thaliana DNA chromosome 4, BAC clone F28J12 (ESSAII
           project)
          Length = 110102

 Score = 40.1 bits (20), Expect = 0.98
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 41  taaatatatattcaatactt 60
           ||||||||||||||||||||
Sbjct: 82  taaatatatattcaatactt 101
to top
>emb|AL021713.1|ATT9A21 Arabidopsis thaliana DNA chromosome 4, BAC clone T9A21 (ESSA project)
          Length = 82697

 Score = 40.1 bits (20), Expect = 0.98
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 41    taaatatatattcaatactt 60
             ||||||||||||||||||||
Sbjct: 79660 taaatatatattcaatactt 79679
to top
>gb|AC003684.1| Homo sapiens X BAC GS1-519E5 (Genome Systems Human BAC library) complete
              sequence
          Length = 210954

 Score = 40.1 bits (20), Expect = 0.98
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 59     tttaatccaaatgaacaacg 78
              ||||||||||||||||||||
Sbjct: 100824 tttaatccaaatgaacaacg 100843
to top
>emb|AL732452.5| Mouse DNA sequence from clone RP23-177C20 on chromosome 2, complete
             sequence
          Length = 190165

 Score = 40.1 bits (20), Expect = 0.98
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    tttatgcataaatatatatt 52
             ||||||||||||||||||||
Sbjct: 92550 tttatgcataaatatatatt 92569
to top
>emb|AL928876.12| Mouse DNA sequence from clone RP23-236O6 on chromosome 2, complete
             sequence
          Length = 201545

 Score = 40.1 bits (20), Expect = 0.98
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 46    atatattcaatactttaatc 65
             ||||||||||||||||||||
Sbjct: 60424 atatattcaatactttaatc 60443
to top
>gb|AC112265.5| Mus musculus BAC clone RP23-421N20 from 10, complete sequence
          Length = 203204

 Score = 40.1 bits (20), Expect = 0.98
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 41    taaatatatattcaatactttaat 64
             |||||||||||| |||||||||||
Sbjct: 39639 taaatatatattaaatactttaat 39662
to top
>gb|AC110904.8| Mus musculus chromosome 7, clone RP24-174I24, complete sequence
          Length = 150036

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 39    cataaatatatattcaata 57
             |||||||||||||||||||
Sbjct: 37070 cataaatatatattcaata 37052
to top
>ref|XM_950667.1| Neurospora crassa OR74A hypothetical protein (NCU03422.1) partial
           mRNA
          Length = 1608

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 5   ggagctgggcctccaaaac 23
           |||||||||||||||||||
Sbjct: 765 ggagctgggcctccaaaac 747
to top
>gb|AC116774.9| Mus musculus chromosome 3, clone RP24-361N19, complete sequence
          Length = 147728

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 35    tatgcataaatatatattcaata 57
             |||||||||||||||||| ||||
Sbjct: 31569 tatgcataaatatatatttaata 31547
to top
>gb|AC185988.2| Pan troglodytes BAC clone CH251-398L15 from chromosome 6, complete
              sequence
          Length = 148530

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 33     tttatgcataaatatatat 51
              |||||||||||||||||||
Sbjct: 137700 tttatgcataaatatatat 137718
to top
>ref|XM_322679.1| Neurospora crassa OR74A predicted protein (NCU03422.1) partial mRNA
          Length = 1608

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 5   ggagctgggcctccaaaac 23
           |||||||||||||||||||
Sbjct: 765 ggagctgggcctccaaaac 747
to top
>gb|AC140311.2| Mus musculus BAC clone RP23-392M3 from chromosome 9, complete sequence
          Length = 195460

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 32     ttttatgcataaatatata 50
              |||||||||||||||||||
Sbjct: 179840 ttttatgcataaatatata 179858
to top
>gb|AC162901.4| Mus musculus BAC clone RP23-417K5 from chromosome 8, complete sequence
          Length = 205244

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 35     tatgcataaatatatattcaata 57
              |||||||| ||||||||||||||
Sbjct: 110586 tatgcatatatatatattcaata 110608
to top
>gb|AC184157.2| Pan troglodytes BAC clone CH251-31B9 from chromosome 15, complete
             sequence
          Length = 167965

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 33    tttatgcataaatatatat 51
             |||||||||||||||||||
Sbjct: 54152 tttatgcataaatatatat 54170
to top
>gb|AC184054.2| Pan troglodytes BAC clone CH251-706J5 from chromosome 15, complete
             sequence
          Length = 177821

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 33    tttatgcataaatatatat 51
             |||||||||||||||||||
Sbjct: 97328 tttatgcataaatatatat 97310
to top
>gb|AC147344.2| Pan troglodytes BAC clone CH251-4O16 from Y, complete sequence
          Length = 186607

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 39    cataaatatatattcaata 57
             |||||||||||||||||||
Sbjct: 41372 cataaatatatattcaata 41390
to top
>gb|AC122416.4| Mus musculus BAC clone RP24-157E17 from chromosome 9, complete sequence
          Length = 140024

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 32    ttttatgcataaatatata 50
             |||||||||||||||||||
Sbjct: 50984 ttttatgcataaatatata 51002
to top
>gb|AC115119.5| Mus musculus BAC clone RP23-87M19 from 18, complete sequence
          Length = 174491

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    gccatcctttttatgcata 42
             |||||||||||||||||||
Sbjct: 80401 gccatcctttttatgcata 80419
to top
>emb|CR848676.7| Zebrafish DNA sequence from clone DKEY-265I7 in linkage group 9,
             complete sequence
          Length = 96536

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 36    atgcataaatatatattca 54
             |||||||||||||||||||
Sbjct: 86914 atgcataaatatatattca 86896
to top
>gb|AC146206.3| Pan troglodytes BAC clone CH251-395K13 from Y, complete sequence
          Length = 161960

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 39     cataaatatatattcaata 57
              |||||||||||||||||||
Sbjct: 133362 cataaatatatattcaata 133344
to top
>gb|AY371488.1| Zea mays clone BAC 276N12-123C01, partial sequence
          Length = 213888

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 54    aatactttaatccaaatgaacaa 76
             |||| ||||||||||||||||||
Sbjct: 17131 aatagtttaatccaaatgaacaa 17153
to top
>ref|XM_669732.1| Plasmodium berghei strain ANKA hypothetical protein (PB103064.00.0)
           partial mRNA
          Length = 148

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 34  ttatgcataaatatatatt 52
           |||||||||||||||||||
Sbjct: 121 ttatgcataaatatatatt 103
to top
>gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequence
          Length = 114535

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 33    tttatgcataaatatatat 51
             |||||||||||||||||||
Sbjct: 31126 tttatgcataaatatatat 31144
to top
>emb|AL355504.17| Human DNA sequence from clone RP11-218A18 on chromosome 13 Contains a
             mitochondrial import receptor Tom22 pseudogene, complete
             sequence
          Length = 60159

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 42    aaatatatattcaatactt 60
             |||||||||||||||||||
Sbjct: 19160 aaatatatattcaatactt 19142
to top
>emb|AL353623.16| Human DNA sequence from clone RP11-376H15 on chromosome 13 Contains the
              5' end of a novel gene and a CpG island, complete sequence
          Length = 128538

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 31     tttttatgcataaatatat 49
              |||||||||||||||||||
Sbjct: 123156 tttttatgcataaatatat 123174
to top
>emb|AL031650.22|HS1018D12 Human DNA sequence from clone RP5-1018D12 on chromosome 20q11.1-11.22
             Contains part of a CDK5 regulatory subunit associated
             protein 3 (CDK5RAP3) pseudogene, the RPL31P3 gene for
             ribosomal protein L31 pseudogene 3, a novel pseudogene,
             the DEFB118 gene for defensin beta 118 and the 3' end of
             the the DEFB119 gene for defensin beta 119, complete
             sequence
          Length = 98490

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 40    ataaatatatattcaatac 58
             |||||||||||||||||||
Sbjct: 70188 ataaatatatattcaatac 70170
to top
>emb|AL031903.2|HS1032F13 Human DNA sequence from clone RP5-1032F13 on chromosome Xq25-26.3
             Contains a keratin 18 (KRT18) pseudogene, complete
             sequence
          Length = 27518

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 52    tcaatactttaatccaaat 70
             |||||||||||||||||||
Sbjct: 23222 tcaatactttaatccaaat 23240
to top
>emb|Z92540.1|HS179I15A Human DNA sequence from clone RP1-179I15 on chromosome 13. Contains a
             novel gene, a mitochondrial import receptor TOM22
             pseudogene, the 5' end of the KL gene for klotho, ESTs,
             STSs and a CpG island, complete sequence
          Length = 146810

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 42    aaatatatattcaatactt 60
             |||||||||||||||||||
Sbjct: 50916 aaatatatattcaatactt 50898
to top
>emb|Z26877.1|SCDCHR11 S.cerevisiae (S288C) 36.2kb DNA fragment from chromosome 11
          Length = 36272

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 46    atatattcaatactttaat 64
             |||||||||||||||||||
Sbjct: 23511 atatattcaatactttaat 23493
to top
>emb|AL669991.1|NCB11B23 Neurospora crassa DNA linkage group II BAC clone B11B23
          Length = 79554

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     ggagctgggcctccaaaac 23
             |||||||||||||||||||
Sbjct: 57915 ggagctgggcctccaaaac 57933
to top
>gb|AC007051.3| Homo sapiens chromosome 3, clone hRPK.44_A_1, complete sequence
          Length = 167810

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 29     cctttttatgcataaatat 47
              |||||||||||||||||||
Sbjct: 137444 cctttttatgcataaatat 137426
to top
>dbj|BS000553.1| Pan troglodytes chromosome Y clone:PTB-310C12, complete sequences
          Length = 120948

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 39    cataaatatatattcaata 57
             |||||||||||||||||||
Sbjct: 53223 cataaatatatattcaata 53205
to top
>emb|BX276108.6| Zebrafish DNA sequence from clone CH211-265M17 in linkage group 24,
              complete sequence
          Length = 144165

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 35     tatgcataaatatatattcaata 57
              |||||||| ||||||||||||||
Sbjct: 103409 tatgcatatatatatattcaata 103431
to top
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 39       cataaatatatattcaata 57
                |||||||||||||||||||
Sbjct: 23541784 cataaatatatattcaata 23541802
to top
>gb|AC182493.3| Pan troglodytes BAC clone CH251-215H7 from chromosome 15, complete
             sequence
          Length = 156271

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 33    tttatgcataaatatatat 51
             |||||||||||||||||||
Sbjct: 50322 tttatgcataaatatatat 50304
to top
>gb|AC021642.14| Mus musculus chromosome 10 clone  RP23-113O5, containing myf5 and myf6,
             complete sequence
          Length = 203839

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 34    ttatgcataaatatatatt 52
             |||||||||||||||||||
Sbjct: 79318 ttatgcataaatatatatt 79300
to top
>gb|AC016938.24| Homo sapiens 3 BAC RP11-196F13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 41001

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    cctttttatgcataaatat 47
             |||||||||||||||||||
Sbjct: 38120 cctttttatgcataaatat 38138
to top
>gb|AC026884.7| Homo sapiens chromosome 10 clone RP11-123G9, complete sequence
          Length = 142093

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    tatgcataaatatatattc 53
             |||||||||||||||||||
Sbjct: 89441 tatgcataaatatatattc 89459
to top
>gb|AC104136.5| Homo sapiens BAC clone RP11-782E2 from 4, complete sequence
          Length = 149715

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 32    ttttatgcataaatatata 50
             |||||||||||||||||||
Sbjct: 89773 ttttatgcataaatatata 89791
to top
>gb|AY071587.1| Drosophila melanogaster RE64145 full length cDNA
          Length = 541

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 31  tttttatgcataaatatat 49
           |||||||||||||||||||
Sbjct: 530 tttttatgcataaatatat 512
to top
>gb|AC024569.5| Homo sapiens chromosome 5 clone CTD-2188H20, complete sequence
          Length = 193547

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 32     ttttatgcataaatatata 50
              |||||||||||||||||||
Sbjct: 172366 ttttatgcataaatatata 172348
to top
>gb|AC020977.6| Homo sapiens chromosome 5 clone RP11-92M7, complete sequence
          Length = 156105

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 32     ttttatgcataaatatata 50
              |||||||||||||||||||
Sbjct: 154856 ttttatgcataaatatata 154838
to top
>emb|BX248323.8| Zebrafish DNA sequence from clone CH211-199J6, complete sequence
          Length = 177714

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 30    ctttttatgcataaatata 48
             |||||||||||||||||||
Sbjct: 48413 ctttttatgcataaatata 48431
to top
>gb|AC158653.7| Mus musculus 6 BAC RP23-418F10 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 185818

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 39     cataaatatatattcaata 57
              |||||||||||||||||||
Sbjct: 100952 cataaatatatattcaata 100970
to top
>gb|AY913763.1| Pan troglodytes ZFY (ZFY) gene, complete cds
          Length = 167166

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 39     cataaatatatattcaata 57
              |||||||||||||||||||
Sbjct: 103678 cataaatatatattcaata 103660
to top
>gb|AC008901.5|AC008901 Homo sapiens chromosome 5 clone CTD-2245E22, complete sequence
          Length = 165916

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 32     ttttatgcataaatatata 50
              |||||||||||||||||||
Sbjct: 160785 ttttatgcataaatatata 160803
to top
>gb|AC007559.3| Homo sapiens BAC clone RP11-364J6 from 2, complete sequence
          Length = 156374

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 36    atgcataaatatatattca 54
             |||||||||||||||||||
Sbjct: 53973 atgcataaatatatattca 53955
to top
>gb|AC013412.3|AC013412 Homo sapiens BAC clone RP11-507A3 from Y, complete sequence
          Length = 200214

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 39    cataaatatatattcaata 57
             |||||||||||||||||||
Sbjct: 66724 cataaatatatattcaata 66706
to top
>emb|AJ330214.1|HSA330214 Homo sapiens genomic sequence surrounding NotI site, clone
           HSJ8P-G7RS
          Length = 740

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 11  gggcctccaaaacgccatc 29
           |||||||||||||||||||
Sbjct: 707 gggcctccaaaacgccatc 689
to top
>emb|CR381692.13| Zebrafish DNA sequence from clone CH211-242K1 in linkage group 21,
             complete sequence
          Length = 178916

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 42    aaatatatattcaatactttaat 64
             |||| ||||||||||||||||||
Sbjct: 12570 aaatgtatattcaatactttaat 12548
to top
>gb|AC149381.2| Phakopsora pachyrhizi clone JGIAFNA-5A7, complete sequence
          Length = 35166

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 31    tttttatgcataaatatat 49
             |||||||||||||||||||
Sbjct: 19648 tttttatgcataaatatat 19666
to top
>emb|BX537305.32| Zebrafish DNA sequence from clone DKEY-45L12, complete sequence
          Length = 186856

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 40     ataaatatatattcaatacttta 62
              |||||||||||||||||| ||||
Sbjct: 155304 ataaatatatattcaatatttta 155326
to top
>emb|Z28156.1|SCYKL156W S.cerevisiae chromosome XI reading frame ORF YKL156w
          Length = 1274

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 46   atatattcaatactttaat 64
            |||||||||||||||||||
Sbjct: 1237 atatattcaatactttaat 1219
to top
>emb|Z28155.1|SCYKL155C S.cerevisiae chromosome XI reading frame ORF YKL155c
          Length = 2634

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 46  atatattcaatactttaat 64
           |||||||||||||||||||
Sbjct: 452 atatattcaatactttaat 434
to top
>emb|AL928598.7| Mouse DNA sequence from clone RP23-326I20 on chromosome 2, complete
              sequence
          Length = 148583

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 33     tttatgcataaatatatat 51
              |||||||||||||||||||
Sbjct: 108671 tttatgcataaatatatat 108689
to top
>gb|AC124491.5| Mus musculus BAC clone RP23-454B2 from chromosome 8, complete sequence
          Length = 187779

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 35    tatgcataaatatatattcaata 57
             |||||||| ||||||||||||||
Sbjct: 23922 tatgcatatatatatattcaata 23900
to top
>gb|AC134623.5| Mus musculus BAC clone RP23-20K21 from 8, complete sequence
          Length = 234976

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 40    ataaatatatattcaatacttta 62
             ||||||||||||| |||||||||
Sbjct: 61217 ataaatatatattaaatacttta 61239
to top
>gb|AC132137.3| Mus musculus BAC clone RP23-153E2 from 3, complete sequence
          Length = 196413

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 35     tatgcataaatatatattcaata 57
              |||||||| ||||||||||||||
Sbjct: 112122 tatgcatatatatatattcaata 112144
to top
>emb|AL807236.11| Mouse DNA sequence from clone RP23-219O14 on chromosome 4, complete
              sequence
          Length = 201437

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 33     tttatgcataaatatatattcaa 55
              ||||||||||||| |||||||||
Sbjct: 191819 tttatgcataaatttatattcaa 191797
to top
>dbj|AP005117.2| Homo sapiens genomic DNA, chromosome 18p clone:RP11-21G15, complete
              sequences
          Length = 148790

 Score = 38.2 bits (19), Expect = 3.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 33     tttatgcataaatatatat 51
              |||||||||||||||||||
Sbjct: 113154 tttatgcataaatatatat 113136


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,462,800
Number of Sequences: 3902068
Number of extensions: 1462800
Number of successful extensions: 132665
Number of sequences better than 10.0: 70
Number of HSP's better than 10.0 without gapping: 70
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 132385
Number of HSP's gapped (non-prelim): 280
length of query: 90
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 69
effective length of database: 17,151,101,840
effective search space: 1183426026960
effective search space used: 1183426026960
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top