ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl13b12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP004492.1| Lotus japonicus genomic DNA, chromosome 4, clone... 44 0.19
2gb|AY392534.1| Porcine teschovirus isolate DS 756/93 polyprotein... 42 0.76
3gb|AC184157.2| Pan troglodytes BAC clone CH251-31B9 from chromos... 42 0.76
4gb|AC184054.2| Pan troglodytes BAC clone CH251-706J5 from chromo... 42 0.76
5emb|Z48716.1|CEF59B10 Caenorhabditis elegans Cosmid F59B10, comp... 42 0.76
6ref|XM_758575.1| Theileria parva strain Muguga chromosome 4 aden... 42 0.76
7gb|AC007321.2| Homo sapiens BAC clone RP11-507C1 from 7, complet... 42 0.76
8gb|AC087433.4|AC087433 Homo sapiens chromosome 15 clone RP11-101... 42 0.76
9gb|AF296101.1|AF296101 Porcine teschovirus strain Sek 549/98 pol... 42 0.76
10gb|AF296091.1|AF296091 Porcine teschovirus strain PS 37 polyprot... 42 0.76
11emb|AL935147.9| Mouse DNA sequence from clone RP23-33O19 on chro... 42 0.76
12gb|AC162373.11| Mus musculus chromosome 18, clone RP23-410M11, c... 40 3.0
13gb|AY392539.1| Porcine teschovirus isolate UKG/170/80 polyprotei... 40 3.0
14gb|AY392533.1| Porcine teschovirus isolate DS 183/93 polyprotein... 40 3.0
15gb|AC095999.8| Rattus norvegicus 4 BAC CH230-12B2 (Children's Ho... 40 3.0
16gb|AC161886.4| Pan troglodytes BAC clone CH251-708N9 from chromo... 40 3.0
17ref|XM_453499.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D09801g ... 40 3.0
18gb|AC144408.3| Mus musculus BAC clone RP24-326P8 from chromosome... 40 3.0
19emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 3.0
20emb|CR855858.5| Zebrafish DNA sequence from clone CH211-113H5 in... 40 3.0
21gb|AC126564.7| Homo sapiens 12 BAC RP11-638F5 (Roswell Park Canc... 40 3.0
22emb|BX322537.14| Zebrafish DNA sequence from clone CH211-262H21 ... 40 3.0
23gb|AC164165.2| Mus musculus BAC clone RP23-145F16 from chromosom... 40 3.0
24gb|AC021878.4| Homo sapiens BAC clone RP11-18N21 from 4, complet... 40 3.0
25gb|AC146074.4| Pan troglodytes BAC clone RP43-15D8 from chromoso... 40 3.0
26emb|AL357615.7|HS373D10 Homo sapiens chromosome 9 BAC RP11-373D1... 40 3.0
27emb|AL391667.19| Human DNA sequence from clone RP11-214L15 on ch... 40 3.0

>dbj|AP004492.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT08D16, TM0025a,
            complete sequence
          Length = 51575

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 173  aatcaaatttcactttgaaatg 194
            ||||||||||||||||||||||
Sbjct: 2106 aatcaaatttcactttgaaatg 2127



to top

>gb|AY392534.1| Porcine teschovirus isolate DS 756/93 polyprotein gene, partial cds
          Length = 3721

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 156 tgcagtgtcatcccaagaatcaaat 180
           |||| ||||||||||||||||||||
Sbjct: 729 tgcaatgtcatcccaagaatcaaat 753



to top

>gb|AC184157.2| Pan troglodytes BAC clone CH251-31B9 from chromosome 15, complete
              sequence
          Length = 167965

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 187    ttgaaatgttacataaataatagaa 211
              ||||||||||||||||| |||||||
Sbjct: 136889 ttgaaatgttacataaaaaatagaa 136865



to top

>gb|AC184054.2| Pan troglodytes BAC clone CH251-706J5 from chromosome 15, complete
             sequence
          Length = 177821

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 187   ttgaaatgttacataaataatagaa 211
             ||||||||||||||||| |||||||
Sbjct: 14591 ttgaaatgttacataaaaaatagaa 14615



to top

>emb|Z48716.1|CEF59B10 Caenorhabditis elegans Cosmid F59B10, complete sequence
          Length = 27428

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 180   tttcactttgaaatgttacat 200
             |||||||||||||||||||||
Sbjct: 25727 tttcactttgaaatgttacat 25707



to top

>ref|XM_758575.1| Theileria parva strain Muguga chromosome 4 adenylosuccinate
           synthase (TP04_0033) partial mRNA
          Length = 1305

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 4   ttttgatgagaacttcaataagttacaaa 32
           ||||||||| ||||| |||||||||||||
Sbjct: 861 ttttgatgaaaactttaataagttacaaa 889



to top

>gb|AC007321.2| Homo sapiens BAC clone RP11-507C1 from 7, complete sequence
          Length = 158770

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 101    gatctgccagttctttgatgt 121
              |||||||||||||||||||||
Sbjct: 104138 gatctgccagttctttgatgt 104118



to top

>gb|AC087433.4|AC087433 Homo sapiens chromosome 15 clone RP11-101J17 and RP11-501G11 map 15q21.1,
              complete sequence
          Length = 185145

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 187    ttgaaatgttacataaataatagaa 211
              ||||||||||||||||| |||||||
Sbjct: 113538 ttgaaatgttacataaaaaatagaa 113562



to top

>gb|AF296101.1|AF296101 Porcine teschovirus strain Sek 549/98 polyprotein gene, partial cds
          Length = 3434

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 156 tgcagtgtcatcccaagaatcaaat 180
           |||| ||||||||||||||||||||
Sbjct: 453 tgcaatgtcatcccaagaatcaaat 477



to top

>gb|AF296091.1|AF296091 Porcine teschovirus strain PS 37 polyprotein gene, complete cds
          Length = 7018

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 156 tgcagtgtcatcccaagaatcaaat 180
           |||| ||||||||||||||||||||
Sbjct: 703 tgcaatgtcatcccaagaatcaaat 727



to top

>emb|AL935147.9| Mouse DNA sequence from clone RP23-33O19 on chromosome 2, complete
              sequence
          Length = 241249

 Score = 42.1 bits (21), Expect = 0.76
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 187    ttgaaatgttacataaataat 207
              |||||||||||||||||||||
Sbjct: 132441 ttgaaatgttacataaataat 132461



to top

>gb|AC162373.11| Mus musculus chromosome 18, clone RP23-410M11, complete sequence
          Length = 173382

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 172    gaatcaaatttcactttgaaatgt 195
              ||||||||||||| ||||||||||
Sbjct: 107600 gaatcaaatttcagtttgaaatgt 107577



to top

>gb|AY392539.1| Porcine teschovirus isolate UKG/170/80 polyprotein gene, partial
           cds
          Length = 3300

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 161 tgtcatcccaagaatcaaat 180
           ||||||||||||||||||||
Sbjct: 710 tgtcatcccaagaatcaaat 729



to top

>gb|AY392533.1| Porcine teschovirus isolate DS 183/93 polyprotein gene, partial cds
          Length = 3684

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 156 tgcagtgtcatcccaagaatcaaa 179
           |||| |||||||||||||||||||
Sbjct: 715 tgcaatgtcatcccaagaatcaaa 738



to top

>gb|AC095999.8| Rattus norvegicus 4 BAC CH230-12B2 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 217673

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 186    tttgaaatgttacataaata 205
              ||||||||||||||||||||
Sbjct: 181450 tttgaaatgttacataaata 181469



to top

>gb|AC161886.4| Pan troglodytes BAC clone CH251-708N9 from chromosome 7, complete
              sequence
          Length = 205419

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 180    tttcactttgaaatgttacataaataat 207
              |||| ||||||||||| |||||||||||
Sbjct: 187735 tttccctttgaaatgtcacataaataat 187708



to top

>ref|XM_453499.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D09801g predicted mRNA
          Length = 2631

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 4   ttttgatgagaacttcaata 23
           ||||||||||||||||||||
Sbjct: 778 ttttgatgagaacttcaata 759



to top

>gb|AC144408.3| Mus musculus BAC clone RP24-326P8 from chromosome 16, complete sequence
          Length = 167601

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    aagttacaaagcactaacat 42
             ||||||||||||||||||||
Sbjct: 72017 aagttacaaagcactaacat 71998



to top

>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1715506

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 4      ttttgatgagaacttcaata 23
              ||||||||||||||||||||
Sbjct: 828340 ttttgatgagaacttcaata 828321



to top

>emb|CR855858.5| Zebrafish DNA sequence from clone CH211-113H5 in linkage group 24,
             complete sequence
          Length = 152666

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 26    ttacaaagcactaacattct 45
             ||||||||||||||||||||
Sbjct: 62955 ttacaaagcactaacattct 62936



to top

>gb|AC126564.7| Homo sapiens 12 BAC RP11-638F5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 121242

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 187   ttgaaatgttacataaataa 206
             ||||||||||||||||||||
Sbjct: 11611 ttgaaatgttacataaataa 11592



to top

>emb|BX322537.14| Zebrafish DNA sequence from clone CH211-262H21 in linkage group 23,
            complete sequence
          Length = 26459

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   ggtcgctgaggtacatttca 77
            ||||||||||||||||||||
Sbjct: 9306 ggtcgctgaggtacatttca 9325



to top

>gb|AC164165.2| Mus musculus BAC clone RP23-145F16 from chromosome 16, complete
             sequence
          Length = 214546

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    aagttacaaagcactaacat 42
             ||||||||||||||||||||
Sbjct: 66562 aagttacaaagcactaacat 66543



to top

>gb|AC021878.4| Homo sapiens BAC clone RP11-18N21 from 4, complete sequence
          Length = 161391

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 37    taacattctgctgaaaagtttggt 60
             ||||||| ||||||||||||||||
Sbjct: 87888 taacattttgctgaaaagtttggt 87865



to top

>gb|AC146074.4| Pan troglodytes BAC clone RP43-15D8 from chromosome 7, complete sequence
          Length = 196799

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 180    tttcactttgaaatgttacataaataat 207
              |||| ||||||||||| |||||||||||
Sbjct: 180873 tttccctttgaaatgtcacataaataat 180846



to top

>emb|AL357615.7|HS373D10 Homo sapiens chromosome 9 BAC RP11-373D10, complete sequence
          Length = 171446

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 190   aaatgttacataaataatag 209
             ||||||||||||||||||||
Sbjct: 55753 aaatgttacataaataatag 55734



to top

>emb|AL391667.19| Human DNA sequence from clone RP11-214L15 on chromosome 9, complete
             sequence
          Length = 110444

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 190   aaatgttacataaataatag 209
             ||||||||||||||||||||
Sbjct: 23070 aaatgttacataaataatag 23051


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,555,472
Number of Sequences: 3902068
Number of extensions: 2555472
Number of successful extensions: 57047
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57004
Number of HSP's gapped (non-prelim): 43
length of query: 235
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 213
effective length of database: 17,147,199,772
effective search space: 3652353551436
effective search space used: 3652353551436
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top