>gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14, complete sequence
          Length = 153766

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 162   gggacgaaagcctttttcgata 183
             ||||||||||||||||||||||
Sbjct: 19059 gggacgaaagcctttttcgata 19038

>emb|AL359074.12| Human DNA sequence from clone RP11-137L10 on chromosome 10 Contains the
             5' end of the PPP3CB gene for protein phosphatase 3
             (formerly 2B) catalytic subunit beta isoform (calcineurin
             A beta), two novel genes (FLJ37318), the 3' end of a novel
             gene, a ribosomal protein S26 (RPS26) pseudogene and a CpG
             island, complete sequence
          Length = 152161

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 336   aaaacaacctggtaatctccaa 357
             ||||||||||||||||||||||
Sbjct: 43260 aaaacaacctggtaatctccaa 43281

>gb|AC073389.10| Homo sapiens chromosome 10 clone RP11-464F9, complete sequence
          Length = 190681

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 336    aaaacaacctggtaatctccaa 357
              ||||||||||||||||||||||
Sbjct: 177522 aaaacaacctggtaatctccaa 177501

>ref|NM_119225.2| Arabidopsis thaliana unknown protein AT4G30790 mRNA, complete cds
          Length = 3744

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 248  aagtaacagttcgacagctga 268
            |||||||||||||||||||||
Sbjct: 2346 aagtaacagttcgacagctga 2366

>emb|AL161577.2|ATCHRIV73 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 73
          Length = 194862

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 248    aagtaacagttcgacagctga 268
              |||||||||||||||||||||
Sbjct: 141071 aagtaacagttcgacagctga 141051

>gb|AC154038.1| Mus musculus 6 BAC RP23-49L8 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 213878

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 18     tttattaagaaagggaaagca 38
              |||||||||||||||||||||
Sbjct: 205367 tttattaagaaagggaaagca 205347

>gb|AC153860.4| Mus musculus 6 BAC RP23-170C11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 213719

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 18     tttattaagaaagggaaagca 38
              |||||||||||||||||||||
Sbjct: 147382 tttattaagaaagggaaagca 147402

>emb|AL109787.1|ATT10C21 Arabidopsis thaliana DNA chromosome 4, BAC clone T10C21
          Length = 77860

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 248   aagtaacagttcgacagctga 268
             |||||||||||||||||||||
Sbjct: 39955 aagtaacagttcgacagctga 39935

>gb|AC133211.3| Mus musculus BAC clone RP23-36M18 from chromosome 12, complete sequence
          Length = 238126

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    agcagataaaaagtgacaaa 54
             ||||||||||||||||||||
Sbjct: 87420 agcagataaaaagtgacaaa 87439

>gb|AC104299.2| Homo sapiens chromosome 3 clone RP11-129K20, complete sequence
          Length = 181444

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 107   attgatagataacaatacaa 126
             ||||||||||||||||||||
Sbjct: 71080 attgatagataacaatacaa 71099

>emb|Z73103.1|CEC08F8 Caenorhabditis elegans Cosmid C08F8, complete sequence
          Length = 32677

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 134   aaaaactagatatcacatga 153
             ||||||||||||||||||||
Sbjct: 14151 aaaaactagatatcacatga 14170


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,420,417
Number of Sequences: 3902068
Number of extensions: 3420417
Number of successful extensions: 76252
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 76231
Number of HSP's gapped (non-prelim): 21
length of query: 374
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 352
effective length of database: 17,147,199,772
effective search space: 6035814319744
effective search space used: 6035814319744
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)