Clone Name | rbastl13b03 |
---|---|
Clone Library Name | barley_pub |
>gb|AY663392.1| Triticum aestivum cultivar Renan clone BAC 930H14, complete sequence Length = 153766 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 162 gggacgaaagcctttttcgata 183 |||||||||||||||||||||| Sbjct: 19059 gggacgaaagcctttttcgata 19038
>emb|AL359074.12| Human DNA sequence from clone RP11-137L10 on chromosome 10 Contains the 5' end of the PPP3CB gene for protein phosphatase 3 (formerly 2B) catalytic subunit beta isoform (calcineurin A beta), two novel genes (FLJ37318), the 3' end of a novel gene, a ribosomal protein S26 (RPS26) pseudogene and a CpG island, complete sequence Length = 152161 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 336 aaaacaacctggtaatctccaa 357 |||||||||||||||||||||| Sbjct: 43260 aaaacaacctggtaatctccaa 43281
>gb|AC073389.10| Homo sapiens chromosome 10 clone RP11-464F9, complete sequence Length = 190681 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 336 aaaacaacctggtaatctccaa 357 |||||||||||||||||||||| Sbjct: 177522 aaaacaacctggtaatctccaa 177501
>ref|NM_119225.2| Arabidopsis thaliana unknown protein AT4G30790 mRNA, complete cds Length = 3744 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 248 aagtaacagttcgacagctga 268 ||||||||||||||||||||| Sbjct: 2346 aagtaacagttcgacagctga 2366
>emb|AL161577.2|ATCHRIV73 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 73 Length = 194862 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 aagtaacagttcgacagctga 268 ||||||||||||||||||||| Sbjct: 141071 aagtaacagttcgacagctga 141051
>gb|AC154038.1| Mus musculus 6 BAC RP23-49L8 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 213878 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 tttattaagaaagggaaagca 38 ||||||||||||||||||||| Sbjct: 205367 tttattaagaaagggaaagca 205347
>gb|AC153860.4| Mus musculus 6 BAC RP23-170C11 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 213719 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 tttattaagaaagggaaagca 38 ||||||||||||||||||||| Sbjct: 147382 tttattaagaaagggaaagca 147402
>emb|AL109787.1|ATT10C21 Arabidopsis thaliana DNA chromosome 4, BAC clone T10C21 Length = 77860 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 248 aagtaacagttcgacagctga 268 ||||||||||||||||||||| Sbjct: 39955 aagtaacagttcgacagctga 39935
>gb|AC133211.3| Mus musculus BAC clone RP23-36M18 from chromosome 12, complete sequence Length = 238126 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 agcagataaaaagtgacaaa 54 |||||||||||||||||||| Sbjct: 87420 agcagataaaaagtgacaaa 87439
>gb|AC104299.2| Homo sapiens chromosome 3 clone RP11-129K20, complete sequence Length = 181444 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 107 attgatagataacaatacaa 126 |||||||||||||||||||| Sbjct: 71080 attgatagataacaatacaa 71099
>emb|Z73103.1|CEC08F8 Caenorhabditis elegans Cosmid C08F8, complete sequence Length = 32677 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 134 aaaaactagatatcacatga 153 |||||||||||||||||||| Sbjct: 14151 aaaaactagatatcacatga 14170 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,420,417 Number of Sequences: 3902068 Number of extensions: 3420417 Number of successful extensions: 76252 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 76231 Number of HSP's gapped (non-prelim): 21 length of query: 374 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 352 effective length of database: 17,147,199,772 effective search space: 6035814319744 effective search space used: 6035814319744 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)