ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl12h04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY850394.1| Lycopersicon esculentum cultivar Heinz1706 chromo... 42 0.72
2gb|AC114617.16| Mus musculus chromosome 5, clone RP24-84E3, comp... 40 2.9
3gb|DQ215656.1| Taeniopygia guttata clone 0058P0043D04 VAMP - ves... 40 2.9
4gb|DQ215655.1| Taeniopygia guttata clone 0058P0039G03 VAMP - ves... 40 2.9
5emb|CR388171.5| Zebrafish DNA sequence from clone CH211-261O7, c... 40 2.9
6emb|AJ720441.1| Gallus gallus mRNA for hypothetical protein, clo... 40 2.9
7ref|NM_001006296.1| Gallus gallus VAMP (vesicle-associated membr... 40 2.9
8gb|AC082650.6| Homo sapiens BAC clone RP11-419L4 from 4, complet... 40 2.9

>gb|AY850394.1| Lycopersicon esculentum cultivar Heinz1706 chromosome 12 centromeric
             region
          Length = 326112

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 123   aaacataactgaaaaatagtacaaagtct 151
             ||||||| ||||||||||||| |||||||
Sbjct: 57224 aaacatatctgaaaaatagtaaaaagtct 57196



to top

>gb|AC114617.16| Mus musculus chromosome 5, clone RP24-84E3, complete sequence
          Length = 200977

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     gctcaaattcaaaggtagct 25
             ||||||||||||||||||||
Sbjct: 19823 gctcaaattcaaaggtagct 19804



to top

>gb|DQ215656.1| Taeniopygia guttata clone 0058P0043D04 VAMP - vesicle-associated
           membrane protein-associated protein B/C variant 3-like
           mRNA, complete sequence
          Length = 1380

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   acgagctcaaattcaaaggt 21
           ||||||||||||||||||||
Sbjct: 346 acgagctcaaattcaaaggt 365



to top

>gb|DQ215655.1| Taeniopygia guttata clone 0058P0039G03 VAMP - vesicle-associated
           membrane protein-associated protein B/C variant 3-like
           mRNA, complete sequence
          Length = 1380

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 2   acgagctcaaattcaaaggt 21
           ||||||||||||||||||||
Sbjct: 334 acgagctcaaattcaaaggt 353



to top

>emb|CR388171.5| Zebrafish DNA sequence from clone CH211-261O7, complete sequence
          Length = 145218

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    aagggcaacacattatgcat 98
             ||||||||||||||||||||
Sbjct: 96529 aagggcaacacattatgcat 96510



to top

>emb|AJ720441.1| Gallus gallus mRNA for hypothetical protein, clone 17k23
          Length = 1818

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 2  acgagctcaaattcaaaggt 21
          ||||||||||||||||||||
Sbjct: 69 acgagctcaaattcaaaggt 88



to top

>ref|NM_001006296.1| Gallus gallus VAMP (vesicle-associated membrane
          protein)-associated protein B and C (VAPB), mRNA
          Length = 1818

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 2  acgagctcaaattcaaaggt 21
          ||||||||||||||||||||
Sbjct: 69 acgagctcaaattcaaaggt 88



to top

>gb|AC082650.6| Homo sapiens BAC clone RP11-419L4 from 4, complete sequence
          Length = 169408

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 145    aaagtctccattcaaaaatt 164
              ||||||||||||||||||||
Sbjct: 130219 aaagtctccattcaaaaatt 130200


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,073,538
Number of Sequences: 3902068
Number of extensions: 2073538
Number of successful extensions: 136406
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 136386
Number of HSP's gapped (non-prelim): 20
length of query: 224
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 202
effective length of database: 17,147,199,772
effective search space: 3463734353944
effective search space used: 3463734353944
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top