Clone Name | rbastl12g10 |
---|---|
Clone Library Name | barley_pub |
>gb|U56406.1|HVU56406 Hordeum vulgare methyljasmonate-inducible lipoxygenase 2 mRNA, complete cds Length = 3054 Score = 190 bits (96), Expect = 2e-45 Identities = 96/96 (100%) Strand = Plus / Minus Query: 25 catcgtgtcctttaattataatttggtgctcattcccattatacccaccgccgggccaag 84 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3034 catcgtgtcctttaattataatttggtgctcattcccattatacccaccgccgggccaag 2975 Query: 85 agactgaagacactcttatttacgcctagttgagtt 120 |||||||||||||||||||||||||||||||||||| Sbjct: 2974 agactgaagacactcttatttacgcctagttgagtt 2939 Score = 190 bits (96), Expect = 2e-45 Identities = 96/96 (100%) Strand = Plus / Minus Query: 190 cgtccgtgggatcaccgtccgacggcctgagcagcacatacggcaccatgccggcgccgt 249 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2854 cgtccgtgggatcaccgtccgacggcctgagcagcacatacggcaccatgccggcgccgt 2795 Query: 250 gtcggtttttccggtcggggtcgttgttccactcat 285 |||||||||||||||||||||||||||||||||||| Sbjct: 2794 gtcggtttttccggtcggggtcgttgttccactcat 2759 Score = 141 bits (71), Expect = 1e-30 Identities = 74/75 (98%) Strand = Plus / Minus Query: 136 aggcagctcaaatggagatgctgttgggaatgcccatctccatcaccatcttctcgtccg 195 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 2923 aggcagctcaaatggagatgctgttggggatgcccatctccatcaccatcttctcgtccg 2864 Query: 196 tgggatcaccgtccg 210 ||||||||||||||| Sbjct: 2863 tgggatcaccgtccg 2849
>emb|AJ507212.1|HVU507212 Hordeum vulgare mRNA for lipoxygenase 2 (lox2:Hv:2 gene) Length = 3023 Score = 93.7 bits (47), Expect = 3e-16 Identities = 116/139 (83%) Strand = Plus / Minus Query: 145 aaatggagatgctgttgggaatgcccatctccatcaccatcttctcgtccgtgggatcac 204 ||||||| |||||||| ||||||||||||||||||||| | || ||||| | |||| || Sbjct: 2892 aaatggaaatgctgttcggaatgcccatctccatcaccgttttagcgtccatcggattac 2833 Query: 205 cgtccgacggcctgagcagcacatacggcaccatgccggcgccgtgtcggtttttccggt 264 ||| | | |||||||||||||| |||||||| | |||||| ||||| |||||| ||||| Sbjct: 2832 cgttcaatggcctgagcagcacgtacggcactacgccggcaccgtggcggtttctccggc 2773 Query: 265 cggggtcgttgttccactc 283 | ||| ||||||||||| Sbjct: 2772 tgtcgtccttgttccactc 2754
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 140 agctcaaatggagatgctgttgggaatgcccatctccatcacc 182 |||||||||||||||||||||||| |||||||||||||||||| Sbjct: 22970463 agctcaaatggagatgctgttggggatgcccatctccatcacc 22970421 Score = 69.9 bits (35), Expect = 4e-09 Identities = 95/115 (82%) Strand = Plus / Plus Query: 142 ctcaaatggagatgctgttgggaatgcccatctccatcaccatcttctcgtccgtgggat 201 ||||||| |||||||||||||| || |||||||||||||| | || |||| | || | Sbjct: 22888635 ctcaaattgagatgctgttggggatacccatctccatcacggacgtcatgtccttagggt 22888694 Query: 202 caccgtccgacggcctgagcagcacatacggcaccatgccggcgccgtgtcggtt 256 |||||| |||||| |||||||||| |||||||||| ||||| ||| || ||||| Sbjct: 22888695 caccgtaggacggcttgagcagcacgtacggcaccacgccggggccctgccggtt 22888749
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 140 agctcaaatggagatgctgttgggaatgcccatctccatcacc 182 |||||||||||||||||||||||| |||||||||||||||||| Sbjct: 22898654 agctcaaatggagatgctgttggggatgcccatctccatcacc 22898612 Score = 69.9 bits (35), Expect = 4e-09 Identities = 95/115 (82%) Strand = Plus / Plus Query: 142 ctcaaatggagatgctgttgggaatgcccatctccatcaccatcttctcgtccgtgggat 201 ||||||| |||||||||||||| || |||||||||||||| | || |||| | || | Sbjct: 22816826 ctcaaattgagatgctgttggggatacccatctccatcacggacgtcatgtccttagggt 22816885 Query: 202 caccgtccgacggcctgagcagcacatacggcaccatgccggcgccgtgtcggtt 256 |||||| |||||| |||||||||| |||||||||| ||||| ||| || ||||| Sbjct: 22816886 caccgtaggacggcttgagcagcacgtacggcaccacgccggggccctgccggtt 22816940
>emb|AL935072.4|CNS08CCO Oryza sativa chromosome 12, . BAC OSJNBa0028L05 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 155568 Score = 77.8 bits (39), Expect = 2e-11 Identities = 42/43 (97%) Strand = Plus / Minus Query: 140 agctcaaatggagatgctgttgggaatgcccatctccatcacc 182 |||||||||||||||||||||||| |||||||||||||||||| Sbjct: 79740 agctcaaatggagatgctgttggggatgcccatctccatcacc 79698
>emb|AJ270938.1|OSA270938 Oryza sativa mRNA for lipoxygenase (rci-1 gene) Length = 3018 Score = 69.9 bits (35), Expect = 4e-09 Identities = 95/115 (82%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccatctccatcaccatcttctcgtccgtgggat 201 ||||||| |||||||||||||| || |||||||||||||| | || |||| | || | Sbjct: 2817 ctcaaattgagatgctgttggggatacccatctccatcacggacgtcatgtccttagggt 2758 Query: 202 caccgtccgacggcctgagcagcacatacggcaccatgccggcgccgtgtcggtt 256 |||||| |||||| |||||||||| |||||||||| ||||| ||| || ||||| Sbjct: 2757 caccgtaggacggcttgagcagcacgtacggcaccacgccggggccctgccggtt 2703
>dbj|AK072241.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023002P20, full insert sequence Length = 3080 Score = 69.9 bits (35), Expect = 4e-09 Identities = 95/115 (82%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccatctccatcaccatcttctcgtccgtgggat 201 ||||||| |||||||||||||| || |||||||||||||| | || |||| | || | Sbjct: 2836 ctcaaattgagatgctgttggggatacccatctccatcacggacgtcatgtccttagggt 2777 Query: 202 caccgtccgacggcctgagcagcacatacggcaccatgccggcgccgtgtcggtt 256 |||||| |||||| |||||||||| |||||||||| ||||| ||| || ||||| Sbjct: 2776 caccgtaggacggcttgagcagcacgtacggcaccacgccggggccctgccggtt 2722
>dbj|AK066737.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013079G10, full insert sequence Length = 2747 Score = 69.9 bits (35), Expect = 4e-09 Identities = 95/115 (82%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccatctccatcaccatcttctcgtccgtgggat 201 ||||||| |||||||||||||| || |||||||||||||| | || |||| | || | Sbjct: 2343 ctcaaattgagatgctgttggggatacccatctccatcacggacgtcatgtccttagggt 2284 Query: 202 caccgtccgacggcctgagcagcacatacggcaccatgccggcgccgtgtcggtt 256 |||||| |||||| |||||||||| |||||||||| ||||| ||| || ||||| Sbjct: 2283 caccgtaggacggcttgagcagcacgtacggcaccacgccggggccctgccggtt 2229
>emb|AL935070.3|CNS08CCM Oryza sativa chromosome 12, . BAC OSJNBa0040P10 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 148705 Score = 69.9 bits (35), Expect = 4e-09 Identities = 95/115 (82%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccatctccatcaccatcttctcgtccgtgggat 201 ||||||| |||||||||||||| || |||||||||||||| | || |||| | || | Sbjct: 68209 ctcaaattgagatgctgttggggatacccatctccatcacggacgtcatgtccttagggt 68150 Query: 202 caccgtccgacggcctgagcagcacatacggcaccatgccggcgccgtgtcggtt 256 |||||| |||||| |||||||||| |||||||||| ||||| ||| || ||||| Sbjct: 68149 caccgtaggacggcttgagcagcacgtacggcaccacgccggggccctgccggtt 68095
>gb|AY111869.1| Zea mays CL452_-8 mRNA sequence Length = 568 Score = 56.0 bits (28), Expect = 6e-05 Identities = 31/32 (96%) Strand = Plus / Minus Query: 141 gctcaaatggagatgctgttgggaatgcccat 172 ||||| |||||||||||||||||||||||||| Sbjct: 369 gctcatatggagatgctgttgggaatgcccat 338
>gb|AY103567.1| Zea mays PCO116252 mRNA sequence Length = 3135 Score = 56.0 bits (28), Expect = 6e-05 Identities = 31/32 (96%) Strand = Plus / Minus Query: 141 gctcaaatggagatgctgttgggaatgcccat 172 ||||| |||||||||||||||||||||||||| Sbjct: 2902 gctcatatggagatgctgttgggaatgcccat 2871
>gb|AF271894.1|AF271894 Zea mays lipoxygenase (LOX) mRNA, complete cds Length = 2845 Score = 50.1 bits (25), Expect = 0.004 Identities = 28/29 (96%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 ||||||||||||||||||| ||||||||| Sbjct: 2623 ctcaaatggagatgctgtttggaatgccc 2595
>ref|XM_469412.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2686 Score = 46.1 bits (23), Expect = 0.060 Identities = 29/31 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccat 172 |||| ||||||||||||||||| |||||||| Sbjct: 2447 ctcagatggagatgctgttggggatgcccat 2417
>ref|XM_469411.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3165 Score = 46.1 bits (23), Expect = 0.060 Identities = 29/31 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccat 172 |||| ||||||||||||||||| |||||||| Sbjct: 2926 ctcagatggagatgctgttggggatgcccat 2896
>gb|AC093017.10| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0024B16 map S2606, complete sequence Length = 124140 Score = 46.1 bits (23), Expect = 0.060 Identities = 29/31 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccat 172 |||| ||||||||||||||||| |||||||| Sbjct: 65817 ctcagatggagatgctgttggggatgcccat 65787
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 46.1 bits (23), Expect = 0.060 Identities = 29/31 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccat 172 |||| ||||||||||||||||| |||||||| Sbjct: 27821687 ctcagatggagatgctgttggggatgcccat 27821657 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Plus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 ||||||||| |||||||||||| |||||| Sbjct: 14300017 ctcaaatggtgatgctgttggggatgccc 14300045 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 atggagatgctgttgggaatgccc 170 ||||||||||||||||| |||||| Sbjct: 30026445 atggagatgctgttggggatgccc 30026422
>emb|AJ507213.1|HVU507213 Hordeum vulgare mRNA for lipoxygenase 2 (lox2:Hv:3 gene) Length = 2967 Score = 46.1 bits (23), Expect = 0.060 Identities = 26/27 (96%) Strand = Plus / Minus Query: 143 tcaaatggagatgctgttgggaatgcc 169 ||||||||||||||||||||| ||||| Sbjct: 2774 tcaaatggagatgctgttggggatgcc 2748 Score = 42.1 bits (21), Expect = 0.94 Identities = 33/37 (89%) Strand = Plus / Minus Query: 211 acggcctgagcagcacatacggcaccatgccggcgcc 247 ||||| |||||||| | |||||||| ||||||||||| Sbjct: 2721 acggcttgagcagctcgtacggcacgatgccggcgcc 2685
>gb|DQ389164.1| Oryza sativa (japonica cultivar-group) dual positional specificity lipoxygenase mRNA, complete cds Length = 3154 Score = 46.1 bits (23), Expect = 0.060 Identities = 29/31 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccat 172 |||| ||||||||||||||||| |||||||| Sbjct: 2920 ctcagatggagatgctgttggggatgcccat 2890
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 46.1 bits (23), Expect = 0.060 Identities = 29/31 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccat 172 |||| ||||||||||||||||| |||||||| Sbjct: 27913011 ctcagatggagatgctgttggggatgcccat 27912981 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Plus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 ||||||||| |||||||||||| |||||| Sbjct: 14294992 ctcaaatggtgatgctgttggggatgccc 14295020 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 atggagatgctgttgggaatgccc 170 ||||||||||||||||| |||||| Sbjct: 30117867 atggagatgctgttggggatgccc 30117844
>dbj|AK105792.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-H08, full insert sequence Length = 1560 Score = 46.1 bits (23), Expect = 0.060 Identities = 29/31 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccat 172 |||| ||||||||||||||||| |||||||| Sbjct: 1333 ctcagatggagatgctgttggggatgcccat 1303
>dbj|AK072869.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023143O17, full insert sequence Length = 2851 Score = 46.1 bits (23), Expect = 0.060 Identities = 29/31 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccat 172 |||| ||||||||||||||||| |||||||| Sbjct: 2598 ctcagatggagatgctgttggggatgcccat 2568
>dbj|AK072689.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023143H13, full insert sequence Length = 3167 Score = 46.1 bits (23), Expect = 0.060 Identities = 29/31 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccat 172 |||| ||||||||||||||||| |||||||| Sbjct: 2928 ctcagatggagatgctgttggggatgcccat 2898
>dbj|AK071121.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079P11, full insert sequence Length = 1726 Score = 46.1 bits (23), Expect = 0.060 Identities = 29/31 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgcccat 172 |||| ||||||||||||||||| |||||||| Sbjct: 1498 ctcagatggagatgctgttggggatgcccat 1468
>ref|XM_464447.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3123 Score = 44.1 bits (22), Expect = 0.24 Identities = 34/38 (89%) Strand = Plus / Minus Query: 211 acggcctgagcagcacatacggcaccatgccggcgccg 248 ||||| |||||||| | |||||||| |||||||||||| Sbjct: 2828 acggcttgagcagctcgtacggcacgatgccggcgccg 2791
>gb|BT008992.1| Triticum aestivum clone wdk2c.pk011.j13:fis, full insert mRNA sequence Length = 1020 Score = 44.1 bits (22), Expect = 0.24 Identities = 28/30 (93%) Strand = Plus / Minus Query: 141 gctcaaatggagatgctgttgggaatgccc 170 ||||| ||||||||||||||||| |||||| Sbjct: 755 gctcagatggagatgctgttggggatgccc 726
>gb|AF465643.1| Zea mays B73 lipoxygenase gene, complete cds Length = 5013 Score = 44.1 bits (22), Expect = 0.24 Identities = 28/30 (93%) Strand = Plus / Minus Query: 141 gctcaaatggagatgctgttgggaatgccc 170 ||||| ||||||||||||||||| |||||| Sbjct: 4664 gctcagatggagatgctgttggggatgccc 4635
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 44.1 bits (22), Expect = 0.24 Identities = 34/38 (89%) Strand = Plus / Plus Query: 211 acggcctgagcagcacatacggcaccatgccggcgccg 248 ||||| |||||||| | |||||||| |||||||||||| Sbjct: 5277016 acggcttgagcagctcgtacggcacgatgccggcgccg 5277053
>dbj|AP004184.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1225_F07 Length = 142772 Score = 44.1 bits (22), Expect = 0.24 Identities = 34/38 (89%) Strand = Plus / Plus Query: 211 acggcctgagcagcacatacggcaccatgccggcgccg 248 ||||| |||||||| | |||||||| |||||||||||| Sbjct: 3319 acggcttgagcagctcgtacggcacgatgccggcgccg 3356
>dbj|AK071915.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013074B03, full insert sequence Length = 3160 Score = 44.1 bits (22), Expect = 0.24 Identities = 34/38 (89%) Strand = Plus / Minus Query: 211 acggcctgagcagcacatacggcaccatgccggcgccg 248 ||||| |||||||| | |||||||| |||||||||||| Sbjct: 2827 acggcttgagcagctcgtacggcacgatgccggcgccg 2790
>dbj|AK061610.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-B01, full insert sequence Length = 2250 Score = 44.1 bits (22), Expect = 0.24 Identities = 34/38 (89%) Strand = Plus / Minus Query: 211 acggcctgagcagcacatacggcaccatgccggcgccg 248 ||||| |||||||| | |||||||| |||||||||||| Sbjct: 1989 acggcttgagcagctcgtacggcacgatgccggcgccg 1952
>gb|AF149803.1|AF149803 Zea mays lipoxygenase mRNA, lipoxygenase-L2 allele, partial cds Length = 2267 Score = 44.1 bits (22), Expect = 0.24 Identities = 28/30 (93%) Strand = Plus / Minus Query: 141 gctcaaatggagatgctgttgggaatgccc 170 ||||| ||||||||||||||||| |||||| Sbjct: 2066 gctcagatggagatgctgttggggatgccc 2037
>gb|BT009097.1| Triticum aestivum clone wkm2c.pk005.n2:fis, full insert mRNA sequence Length = 1129 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| ||||||||||||||||| |||||| Sbjct: 907 ctcagatggagatgctgttggggatgccc 879
>gb|DQ428248.1| Sorghum propinquum locus PRC0271 genomic sequence Length = 810 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 797 ctcagatggagatgctgtttggaatgccc 769
>gb|DQ428247.1| Sorghum bicolor voucher PI585454 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428246.1| Sorghum bicolor voucher PI267539 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428245.1| Sorghum bicolor voucher PI267408 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428244.1| Sorghum bicolor voucher PI221607 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428243.1| Sorghum bicolor voucher PI152702 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428242.1| Sorghum bicolor voucher NSL92371 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428241.1| Sorghum bicolor voucher NSL87902 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428240.1| Sorghum bicolor voucher NSL87666 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428239.1| Sorghum bicolor voucher NSL77217 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428238.1| Sorghum bicolor voucher NSL77034 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428237.1| Sorghum bicolor voucher NSL55243 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428236.1| Sorghum bicolor voucher NSL51365 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428235.1| Sorghum bicolor voucher NSL51030 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|DQ428234.1| Sorghum bicolor voucher BTx623 locus PRC0271 genomic sequence Length = 805 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Minus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 |||| |||||||||||||| ||||||||| Sbjct: 792 ctcagatggagatgctgtttggaatgccc 764
>gb|AC082644.10| Oryza sativa chromosome 3 BAC OSJNBa0013M12 genomic sequence, complete sequence Length = 158714 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Plus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 ||||||||| |||||||||||| |||||| Sbjct: 49246 ctcaaatggtgatgctgttggggatgccc 49274
>gb|AC144427.1| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNAb0012F18, complete sequence Length = 122159 Score = 42.1 bits (21), Expect = 0.94 Identities = 27/29 (93%) Strand = Plus / Plus Query: 142 ctcaaatggagatgctgttgggaatgccc 170 ||||||||| |||||||||||| |||||| Sbjct: 111405 ctcaaatggtgatgctgttggggatgccc 111433
>ref|XM_469655.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2613 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 atggagatgctgttgggaatgccc 170 ||||||||||||||||| |||||| Sbjct: 2609 atggagatgctgttggggatgccc 2586
>ref|XM_524799.1| PREDICTED: Pan troglodytes similar to potassium voltage-gated channel, shaker-related subfamily, member 10; cyclic GMP gated potassium channel (LOC469414), mRNA Length = 1671 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 681 catctccatcaccatcttct 700
>ref|NM_005549.2| Homo sapiens potassium voltage-gated channel, shaker-related subfamily, member 10 (KCNA10), mRNA Length = 1959 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 1069 catctccatcaccatcttct 1088
>gb|BC074990.2| Homo sapiens potassium voltage-gated channel, shaker-related subfamily, member 10, mRNA (cDNA clone MGC:103916 IMAGE:30915306), complete cds Length = 1599 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 711 catctccatcaccatcttct 730
>gb|AC132405.3| Mus musculus BAC clone RP23-332I1 from chromosome 3, complete sequence Length = 207726 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 187186 catctccatcaccatcttct 187167
>ref|XM_582224.2| PREDICTED: Bos taurus similar to potassium voltage-gated channel, shaker-related subfamily, member 10 (LOC538721), mRNA Length = 1643 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 762 catctccatcaccatcttct 781
>ref|XM_983966.1| PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 10 (Kcna10), mRNA Length = 1826 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 840 catctccatcaccatcttct 859
>ref|XM_143471.4| PREDICTED: Mus musculus potassium voltage-gated channel, shaker-related subfamily, member 10 (Kcna10), mRNA Length = 1826 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 840 catctccatcaccatcttct 859
>ref|XM_547232.2| PREDICTED: Canis familiaris similar to potassium voltage-gated channel, shaker-related subfamily, member 10 (LOC490111), mRNA Length = 1650 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 795 catctccatcaccatcttct 814
>gb|AY220737.1| Hordeum vulgare lipoxygenase 1 protein (LOXA) mRNA, partial cds Length = 1331 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 atggagatgctgttgggaatgccc 170 ||||||||||||||||| |||||| Sbjct: 1082 atggagatgctgttggggatgccc 1059
>ref|XM_946728.1| Theileria annulata strain Ankara hypothetical protein (TA15705) partial mRNA Length = 1008 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 169 ccatctccatcaccatcttc 188 |||||||||||||||||||| Sbjct: 95 ccatctccatcaccatcttc 76
>emb|X64396.1|OSLRNA O.sativa mRNA for lipoxygenase L-2 Length = 2830 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 atggagatgctgttgggaatgccc 170 ||||||||||||||||| |||||| Sbjct: 2691 atggagatgctgttggggatgccc 2668
>emb|AL596224.10| Human DNA sequence from clone RP11-26F12 on chromosome 1 Contains part of the CSMD2 gene for CUB and Sushi multiple domains 2, complete sequence Length = 114784 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 29 gtgtcctttaattataattt 48 |||||||||||||||||||| Sbjct: 67048 gtgtcctttaattataattt 67029
>emb|AL358215.16| Human DNA sequence from clone RP11-470L19 on chromosome 1 Contains the 3' end of the PROK1 gene for Prokineticin 1, a putatative novel transcript, an unprocessed pseudogene, a novel transcript and the LOC395116 gene for the shaker subfamily potassium channel KCNA10, complete sequence Length = 101529 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 64506 catctccatcaccatcttct 64487
>gb|AC117988.3| Oryza sativa chromosome 3 BAC OSJNBa0057G07 genomic sequence, complete sequence Length = 155106 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 147 atggagatgctgttgggaatgccc 170 ||||||||||||||||| |||||| Sbjct: 81306 atggagatgctgttggggatgccc 81329
>gb|BC069165.1| Homo sapiens cDNA clone IMAGE:7216995 Length = 1959 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 891 catctccatcaccatcttct 872
>gb|AC010012.5| Drosophila melanogaster 3L BAC RP98-22J16 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 170466 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 169 ccatctccatcaccatcttc 188 |||||||||||||||||||| Sbjct: 69693 ccatctccatcaccatcttc 69712
>dbj|AK157965.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched library, clone:F930012I12 product:Cyclic GMP gated potassium channel homolog [Homo sapiens], full insert sequence Length = 1827 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 841 catctccatcaccatcttct 860
>gb|BC109842.1| Bos taurus cDNA clone MGC:134008 IMAGE:8048005, complete cds Length = 1205 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 148 tggagatgctgttgggaatg 167 |||||||||||||||||||| Sbjct: 778 tggagatgctgttgggaatg 759
>gb|AF329371.1|AF329371 Zea mays lipoxygenase mRNA, complete cds Length = 2595 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 atggagatgctgttgggaatgccc 170 ||||||||||||||||| |||||| Sbjct: 2591 atggagatgctgttggggatgccc 2568
>ref|XM_227577.3| PREDICTED: Rattus norvegicus potassium voltage-gated channel, shaker-related subfamily, member 10 (predicted) (Kcna10_predicted), mRNA Length = 1603 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 710 catctccatcaccatcttct 729
>dbj|AK073529.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033046E17, full insert sequence Length = 2928 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 atggagatgctgttgggaatgccc 170 ||||||||||||||||| |||||| Sbjct: 2724 atggagatgctgttggggatgccc 2701
>gb|AE003474.4| Drosophila melanogaster chromosome 3L, section 8 of 83 of the complete sequence Length = 312072 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 169 ccatctccatcaccatcttc 188 |||||||||||||||||||| Sbjct: 127765 ccatctccatcaccatcttc 127784
>gb|U96110.1|HSU96110 Homo sapiens cyclic GMP gated potassium channel (Kcn1) gene, complete cds Length = 1580 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 690 catctccatcaccatcttct 709
>gb|U32428.1|TAU32428 Triticum aestivum lipoxygenase mRNA, partial cds Length = 1814 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 atggagatgctgttgggaatgccc 170 ||||||||||||||||| |||||| Sbjct: 1552 atggagatgctgttggggatgccc 1529
>gb|U38182.1|OCU38182 Oryctolagus cuniculus cGMP-gated potassium channel (Kcn1) mRNA, complete cds Length = 2178 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 catctccatcaccatcttct 189 |||||||||||||||||||| Sbjct: 1320 catctccatcaccatcttct 1339
>gb|L35931.1|BLYLOXA Barley lipoxygenase 1 (LoxA) gene, complete cds Length = 2818 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 147 atggagatgctgttgggaatgccc 170 ||||||||||||||||| |||||| Sbjct: 2653 atggagatgctgttggggatgccc 2630 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,810,207 Number of Sequences: 3902068 Number of extensions: 1810207 Number of successful extensions: 39796 Number of sequences better than 10.0: 76 Number of HSP's better than 10.0 without gapping: 80 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 39578 Number of HSP's gapped (non-prelim): 218 length of query: 285 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 263 effective length of database: 17,147,199,772 effective search space: 4509713540036 effective search space used: 4509713540036 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)