>ref|XM_763279.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_15_12905_13390) partial mRNA
          Length = 486

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 64  ttgagcaggttctcatcagct 84
           |||||||||||||||||||||
Sbjct: 443 ttgagcaggttctcatcagct 423

>ref|XM_763280.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_15_13494_12943) partial mRNA
          Length = 552

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 64  ttgagcaggttctcatcagct 84
           |||||||||||||||||||||
Sbjct: 148 ttgagcaggttctcatcagct 168

>gb|AC005375.4|AC005375 Homo sapiens chromosome 17, clone hRPK.388_F_14, complete sequence
          Length = 149030

 Score = 42.1 bits (21), Expect = 0.87
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 202   taattatttcccctaaaaatg 222
             |||||||||||||||||||||
Sbjct: 90915 taattatttcccctaaaaatg 90895

>gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118, complete genome
          Length = 1827111

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 93     cctaacagcagcttggcgtacaac 116
              ||||||||| ||||||||||||||
Sbjct: 609609 cctaacagctgcttggcgtacaac 609632

>gb|AC122370.4| Mus musculus BAC clone RP23-459B8 from chromosome 8, complete
            sequence
          Length = 176045

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 44   acaaaatattcaactattgt 63
            ||||||||||||||||||||
Sbjct: 4394 acaaaatattcaactattgt 4413

>gb|AC117189.3| Mus musculus BAC clone RP23-44D2 from 8, complete sequence
          Length = 165254

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     acaaaatattcaactattgt 63
              ||||||||||||||||||||
Sbjct: 123902 acaaaatattcaactattgt 123921

>emb|AL021069.1|HS970D1 Human DNA sequence from clone RP5-970D1 on chromosome 1q24 Contains the
             3' end of a variant of the gene for expressed in
             hematopoietic cells (heart, liver) (HLL), complete
             sequence
          Length = 100496

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 199   aactaattatttcccctaaa 218
             ||||||||||||||||||||
Sbjct: 64950 aactaattatttcccctaaa 64969

>gb|AC021074.15| Homo sapiens 3 BAC RP11-372E1 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 183100

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 42     ttacaaaatattcaactatt 61
              ||||||||||||||||||||
Sbjct: 114164 ttacaaaatattcaactatt 114145

>gb|AC093605.3| Homo sapiens BAC clone RP11-583P24 from 4, complete sequence
          Length = 187035

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 129   ccactgattgcagaggggaa 148
             ||||||||||||||||||||
Sbjct: 27649 ccactgattgcagaggggaa 27630

>gb|AC022735.10| Homo sapiens chromosome 15, clone RP11-519P13, complete sequence
          Length = 176995

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 45     caaaatattcaactattgtt 64
              ||||||||||||||||||||
Sbjct: 149875 caaaatattcaactattgtt 149856

>gb|AC087231.1|AC087231 Caenorhabditis briggsae cosmid CB034P13, complete sequence
          Length = 71462

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 8     ttgcgaaaacatttatatctttcc 31
             |||||||||||||||| |||||||
Sbjct: 68882 ttgcgaaaacatttatttctttcc 68859

>gb|AC091888.3| Homo sapiens chromosome 5 clone RP11-11K15, complete sequence
          Length = 151453

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 32    gtatagcaagttacaaaata 51
             ||||||||||||||||||||
Sbjct: 50726 gtatagcaagttacaaaata 50707


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,891,722
Number of Sequences: 3902068
Number of extensions: 2891722
Number of successful extensions: 57844
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57822
Number of HSP's gapped (non-prelim): 22
length of query: 265
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 243
effective length of database: 17,147,199,772
effective search space: 4166769544596
effective search space used: 4166769544596
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)