ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl12g01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC122241.4| Mus musculus BAC clone RP23-146M20 from chromosom... 42 1.2
2gb|AC166356.1| Mus musculus BAC clone RP23-410F8 from chromosome... 42 1.2
3emb|AL596170.1| Listeria innocua Clip11262 complete genome, segm... 42 1.2
4emb|CR354561.11| Zebrafish DNA sequence from clone DKEY-203K18 i... 42 1.2
5emb|AL672307.9| Mouse DNA sequence from clone RP23-141N2 on chro... 42 1.2
6gb|AC121811.2| Mus musculus BAC clone RP23-453O15 from 5, comple... 40 4.8
7gb|DQ139262.1| Odontoglossum ringspot virus strain Taiwan, compl... 40 4.8
8gb|AC146175.1| Pan troglodytes BAC clone CH251-559G23 from Y, co... 40 4.8
9gb|AC145769.1| Pan troglodytes BAC clone CH251-203H3 from Y, com... 40 4.8
10emb|AL591506.24| Human DNA sequence from clone RP11-112N13 on ch... 40 4.8
11emb|AL591175.6| Zebrafish DNA sequence from clone BUSM1-37I06 in... 40 4.8
12dbj|BS000607.1| Pan troglodytes chromosome Y clone:PTB-081L16, c... 40 4.8
13dbj|BS000558.1| Pan troglodytes chromosome Y clone:PTB-471H19, c... 40 4.8
14gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 40 4.8
15gb|AC118584.18| Papio anubis clone rp41-78d16, complete sequence 40 4.8
16gb|AC117273.41| Papio anubis clone rp41-167h10, complete sequence 40 4.8
17gb|AF272750.1|AF272750 Zea mays kinesin heavy chain (KIN2) mRNA,... 40 4.8
18gb|AC091067.6| Homo sapiens chromosome 18, clone RP11-702M18, co... 40 4.8
19ref|XM_679264.1| PREDICTED: Danio rerio similar to cardiac calci... 40 4.8
20gb|AC026788.4| Homo sapiens chromosome 5 clone CTD-2164M17, comp... 40 4.8
21gb|AC022441.5| Homo sapiens chromosome 5 clone RP11-317O24, comp... 40 4.8
22gb|AC132308.4| Mus musculus BAC clone RP24-292O13 from chromosom... 40 4.8
23gb|AC007275.4|AC007275 Homo sapiens BAC clone RP11-109F19 from Y... 40 4.8
24gb|AC175464.1| Mus musculus BAC clone RP23-129E4 from chromosome... 40 4.8
25gb|AC008831.7|AC008831 Homo sapiens chromosome 5 clone CTD-2146K... 40 4.8
26gb|AC119900.7| Mus musculus chromosome 8, clone RP24-235K6, comp... 40 4.8
27emb|AL591442.2| Zebrafish DNA sequence from clone BUSM1-228J01 i... 40 4.8
28emb|AL591180.4| Zebrafish DNA sequence from clone BUSM1-243A08 i... 40 4.8
29dbj|AP004967.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 4.8

>gb|AC122241.4| Mus musculus BAC clone RP23-146M20 from chromosome 15, complete
             sequence
          Length = 195429

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 281   tcctttttcctcactgtaatg 301
             |||||||||||||||||||||
Sbjct: 89887 tcctttttcctcactgtaatg 89867



to top

>gb|AC166356.1| Mus musculus BAC clone RP23-410F8 from chromosome 15, complete sequence
          Length = 165082

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 281    tcctttttcctcactgtaatg 301
              |||||||||||||||||||||
Sbjct: 129037 tcctttttcctcactgtaatg 129017



to top

>emb|AL596170.1| Listeria innocua Clip11262 complete genome, segment 8/12
          Length = 313450

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 13     gttattttcatccaatgatca 33
              |||||||||||||||||||||
Sbjct: 199007 gttattttcatccaatgatca 198987



to top

>emb|CR354561.11| Zebrafish DNA sequence from clone DKEY-203K18 in linkage group 25,
             complete sequence
          Length = 163175

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 59    aaattaatacatgcagaatgt 79
             |||||||||||||||||||||
Sbjct: 17134 aaattaatacatgcagaatgt 17154



to top

>emb|AL672307.9| Mouse DNA sequence from clone RP23-141N2 on chromosome 2, complete
             sequence
          Length = 206168

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 48    acattcttacaaaattaatac 68
             |||||||||||||||||||||
Sbjct: 63229 acattcttacaaaattaatac 63209



to top

>gb|AC121811.2| Mus musculus BAC clone RP23-453O15 from 5, complete sequence
          Length = 190798

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 291   tcactgtaatggagtagaaa 310
             ||||||||||||||||||||
Sbjct: 26458 tcactgtaatggagtagaaa 26439



to top

>gb|DQ139262.1| Odontoglossum ringspot virus strain Taiwan, complete genome
          Length = 6611

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  ttatgaacattcttacaaaa 61
           ||||||||||||||||||||
Sbjct: 866 ttatgaacattcttacaaaa 885



to top

>gb|AC146175.1| Pan troglodytes BAC clone CH251-559G23 from Y, complete sequence
          Length = 228185

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    aacattcttacaaaattaat 66
             ||||||||||||||||||||
Sbjct: 87265 aacattcttacaaaattaat 87246



to top

>gb|AC145769.1| Pan troglodytes BAC clone CH251-203H3 from Y, complete sequence
          Length = 165958

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    aacattcttacaaaattaat 66
             ||||||||||||||||||||
Sbjct: 25038 aacattcttacaaaattaat 25019



to top

>emb|AL591506.24| Human DNA sequence from clone RP11-112N13 on chromosome 9 Contains a
              pseudogene similar to reverse transcriptase proteins,
              complete sequence
          Length = 175831

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 281    tcctttttcctcactgtaat 300
              ||||||||||||||||||||
Sbjct: 144946 tcctttttcctcactgtaat 144927



to top

>emb|AL591175.6| Zebrafish DNA sequence from clone BUSM1-37I06 in linkage group 8
             Contains four novel genes for a protein similar to MHC
             class II alpha chain proteins, the novel retrotransposon
             SUSHIIDR1 similar to SUSHI-ICHI (Fugu rubripes), a
             putative novel gene, a novel gene for a protein similar to
             MHC class I heavy chain proteins and two novel genes for a
             protein similar toMHC class II beta chain, complete
             sequence
          Length = 89232

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 47    aacattcttacaaaattaatacat 70
             |||||| |||||||||||||||||
Sbjct: 59462 aacattgttacaaaattaatacat 59485



to top

>dbj|BS000607.1| Pan troglodytes chromosome Y clone:PTB-081L16, complete sequences
          Length = 178480

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    aacattcttacaaaattaat 66
             ||||||||||||||||||||
Sbjct: 46059 aacattcttacaaaattaat 46078



to top

>dbj|BS000558.1| Pan troglodytes chromosome Y clone:PTB-471H19, complete sequences
          Length = 156402

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     aacattcttacaaaattaat 66
              ||||||||||||||||||||
Sbjct: 128190 aacattcttacaaaattaat 128209



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     aacattcttacaaaattaat 66
              ||||||||||||||||||||
Sbjct: 559687 aacattcttacaaaattaat 559706



to top

>gb|AC118584.18| Papio anubis clone rp41-78d16, complete sequence
          Length = 189610

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 98     aacattctaaagaattttgagcta 121
              |||||| |||||||||||||||||
Sbjct: 145900 aacattttaaagaattttgagcta 145923



to top

>gb|AC117273.41| Papio anubis clone rp41-167h10, complete sequence
          Length = 184931

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 98   aacattctaaagaattttgagcta 121
            |||||| |||||||||||||||||
Sbjct: 4374 aacattttaaagaattttgagcta 4351



to top

>gb|AF272750.1|AF272750 Zea mays kinesin heavy chain (KIN2) mRNA, partial cds
          Length = 2598

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 325  ttctccttgatcatgttcgagattggctgcca 356
            |||||| |||||||||||||||| || |||||
Sbjct: 2273 ttctccctgatcatgttcgagatgggttgcca 2242



to top

>gb|AC091067.6| Homo sapiens chromosome 18, clone RP11-702M18, complete sequence
          Length = 172192

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 218    aacacagaaaaagctcaatg 237
              ||||||||||||||||||||
Sbjct: 128089 aacacagaaaaagctcaatg 128108



to top

>ref|XM_679264.1| PREDICTED: Danio rerio similar to cardiac calcium channel
           beta-subunit CaB2a (splice variant of the gene CaB2
           (LOC556448), mRNA
          Length = 1791

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 tcgcagccttccttcaccaa 162
           ||||||||||||||||||||
Sbjct: 314 tcgcagccttccttcaccaa 295



to top

>gb|AC026788.4| Homo sapiens chromosome 5 clone CTD-2164M17, complete sequence
          Length = 103505

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 39    aagttatgaacattcttaca 58
             ||||||||||||||||||||
Sbjct: 84976 aagttatgaacattcttaca 84957



to top

>gb|AC022441.5| Homo sapiens chromosome 5 clone RP11-317O24, complete sequence
          Length = 193057

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 39    aagttatgaacattcttaca 58
             ||||||||||||||||||||
Sbjct: 29871 aagttatgaacattcttaca 29890



to top

>gb|AC132308.4| Mus musculus BAC clone RP24-292O13 from chromosome 5, complete sequence
          Length = 184560

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 291    tcactgtaatggagtagaaa 310
              ||||||||||||||||||||
Sbjct: 173664 tcactgtaatggagtagaaa 173645



to top

>gb|AC007275.4|AC007275 Homo sapiens BAC clone RP11-109F19 from Y, complete sequence
          Length = 169904

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     aacattcttacaaaattaat 66
              ||||||||||||||||||||
Sbjct: 127192 aacattcttacaaaattaat 127211



to top

>gb|AC175464.1| Mus musculus BAC clone RP23-129E4 from chromosome 16, complete sequence
          Length = 224605

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 35     tgacaagttatgaacattcttaca 58
              |||||||||| |||||||||||||
Sbjct: 207266 tgacaagttaggaacattcttaca 207289



to top

>gb|AC008831.7|AC008831 Homo sapiens chromosome 5 clone CTD-2146K10, complete sequence
          Length = 144722

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 39    aagttatgaacattcttaca 58
             ||||||||||||||||||||
Sbjct: 27222 aagttatgaacattcttaca 27241



to top

>gb|AC119900.7| Mus musculus chromosome 8, clone RP24-235K6, complete sequence
          Length = 174540

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     atgaacattcttacaaaatt 63
              ||||||||||||||||||||
Sbjct: 111169 atgaacattcttacaaaatt 111188



to top

>emb|AL591442.2| Zebrafish DNA sequence from clone BUSM1-228J01 in linkage group 8,
             complete sequence
          Length = 99866

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 47    aacattcttacaaaattaatacat 70
             |||||| |||||||||||||||||
Sbjct: 73177 aacattgttacaaaattaatacat 73154



to top

>emb|AL591180.4| Zebrafish DNA sequence from clone BUSM1-243A08 in linkage group 8
            Contains a novel and partly predicted gene for a protein
            similar to major histocompatibility complex class II DCB
            gene (mhc2dcb), MHC2DBC related sequence (mhc2dbc-rs),
            part of a novel gene for a protein similar to MHC class
            II alpha chain, the fzd10 gene for frizzled homologue 10
            and a GpC island, complete sequence
          Length = 80272

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 47   aacattcttacaaaattaatacat 70
            |||||| |||||||||||||||||
Sbjct: 5794 aacattgttacaaaattaatacat 5817



to top

>dbj|AP004967.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT27L02, TM0144,
             complete sequence
          Length = 89959

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    aaaattaatacatgcagaat 77
             ||||||||||||||||||||
Sbjct: 46582 aaaattaatacatgcagaat 46601


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,964,879
Number of Sequences: 3902068
Number of extensions: 3964879
Number of successful extensions: 75915
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75841
Number of HSP's gapped (non-prelim): 74
length of query: 362
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 340
effective length of database: 17,147,199,772
effective search space: 5830047922480
effective search space used: 5830047922480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top