>gb|AC114987.10| Mus musculus chromosome 3, clone RP23-81D7, complete sequence
          Length = 179717

 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 159   taatatattgtaatgctttttt 180
             ||||||||||||||||||||||
Sbjct: 68406 taatatattgtaatgctttttt 68427

>emb|AL929469.10| Zebrafish DNA sequence from clone CH211-149K17 in linkage group 12,
             complete sequence
          Length = 146415

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 149   agcatactattaatatattgt 169
             |||||||||||||||||||||
Sbjct: 80947 agcatactattaatatattgt 80967

>gb|AC129596.3| Mus musculus BAC clone RP23-261I2 from 1, complete sequence
          Length = 162998

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 147   tgagcatactattaatatatt 167
             |||||||||||||||||||||
Sbjct: 23581 tgagcatactattaatatatt 23601

>gb|AC167974.3| Mus musculus BAC clone RP23-314B11 from chromosome 1, complete sequence
          Length = 210757

 Score = 42.1 bits (21), Expect = 0.91
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 147    tgagcatactattaatatatt 167
              |||||||||||||||||||||
Sbjct: 164804 tgagcatactattaatatatt 164824

>emb|BX901973.12| Zebrafish DNA sequence from clone DKEY-26L17 in linkage group 3, complete
              sequence
          Length = 226081

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 175    ttttttattgagtttatatc 194
              ||||||||||||||||||||
Sbjct: 155584 ttttttattgagtttatatc 155603

>ref|NG_000018.1| Homo sapiens type I (acidic) hair keratin gene cluster (KRTHA.1@) on
             chromosome 17
          Length = 100000

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   tactattaatatattgtaat 172
             ||||||||||||||||||||
Sbjct: 96099 tactattaatatattgtaat 96080

>gb|AC007318.4| Homo sapiens BAC clone RP11-420C9 from 2, complete sequence
          Length = 204230

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 172   tgcttttttattgagtttat 191
             ||||||||||||||||||||
Sbjct: 64234 tgcttttttattgagtttat 64215

>gb|AC003958.2| Homo sapiens chromosome 17, clone RP5-18F17, complete sequence
          Length = 127833

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   tactattaatatattgtaat 172
             ||||||||||||||||||||
Sbjct: 96098 tactattaatatattgtaat 96079

>ref|XM_231456.3| PREDICTED: Rattus norvegicus similar to chromodomain protein, Y
            chromosome-like isoform a (LOC296877), mRNA
          Length = 3210

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 74   ttcagtaggcctaatgacca 93
            ||||||||||||||||||||
Sbjct: 1815 ttcagtaggcctaatgacca 1834

>gb|AC160563.2| Ornithorhynchus anatinus BAC clone OABb-456P24 from chromosome unknown,
             complete sequence
          Length = 152763

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 210   tgtgcgtgcttgaatacaat 229
             ||||||||||||||||||||
Sbjct: 71122 tgtgcgtgcttgaatacaat 71141

>gb|AC163695.2| Ornithorhynchus anatinus BAC clone OABb-35L5 from chromosome unknown,
             complete sequence
          Length = 89299

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   agcaattccctagtattagg 263
             ||||||||||||||||||||
Sbjct: 10707 agcaattccctagtattagg 10726


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,501,938
Number of Sequences: 3902068
Number of extensions: 2501938
Number of successful extensions: 49236
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 49221
Number of HSP's gapped (non-prelim): 15
length of query: 275
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 253
effective length of database: 17,147,199,772
effective search space: 4338241542316
effective search space used: 4338241542316
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)