>gb|AC097487.2| Homo sapiens BAC clone RP11-217C7 from 4, complete sequence
          Length = 165504

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 13   taacattataaactgtataaat 34
            ||||||||||||||||||||||
Sbjct: 6254 taacattataaactgtataaat 6275

>gb|AC104882.30| Mus musculus chromosome 8, clone RP23-401L9, complete sequence
          Length = 209525

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 374   accctggcagggtcagtccatctct 398
             ||||||||||||||||| |||||||
Sbjct: 97446 accctggcagggtcagtgcatctct 97470

>gb|BC058383.1| Mus musculus TATA box binding protein (Tbp)-associated factor, RNA
           polymerase I, C, mRNA (cDNA clone MGC:66914
           IMAGE:6811470), complete cds
          Length = 3221

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 374 accctggcagggtcagtccatctct 398
           ||||||||||||||||| |||||||
Sbjct: 167 accctggcagggtcagtgcatctct 143

>ref|XM_533039.2| PREDICTED: Canis familiaris similar to phosphodiesterase 4D
            interacting protein isoform 1 (LOC475831), mRNA
          Length = 2006

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 213  gcgcagctcggcggccgcgtccctc 237
            |||| ||||||||||||||||||||
Sbjct: 1480 gcgcggctcggcggccgcgtccctc 1456

>gb|BC051944.1| Mus musculus TATA box binding protein (Tbp)-associated factor, RNA
           polymerase I, C, mRNA (cDNA clone IMAGE:6402661),
           containing frame-shift errors
          Length = 3350

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 374 accctggcagggtcagtccatctct 398
           ||||||||||||||||| |||||||
Sbjct: 204 accctggcagggtcagtgcatctct 180

>gb|AE012192.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 100
            of 460 of the complete genome
          Length = 11053

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 210  cgtgcgcagctcggcggccgcgtcc 234
            ||||||||||||| |||||||||||
Sbjct: 3558 cgtgcgcagctcgccggccgcgtcc 3582

>dbj|AK154846.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630109E21
           product:TATA box binding protein (Tbp)-associated
           factor, RNA polymerase I, C, full insert sequence
          Length = 3238

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 374 accctggcagggtcagtccatctct 398
           ||||||||||||||||| |||||||
Sbjct: 209 accctggcagggtcagtgcatctct 185

>dbj|AK156718.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830043M18 product:TATA box binding
           protein (Tbp)-associated factor, RNA polymerase I, C,
           full insert sequence
          Length = 3187

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 374 accctggcagggtcagtccatctct 398
           ||||||||||||||||| |||||||
Sbjct: 192 accctggcagggtcagtgcatctct 168

>dbj|AK052250.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched
           library, clone:D330013I04 product:TATA box binding
           protein (Tbp)-associated factor, RNA polymerase I, C,
           full insert sequence
          Length = 3475

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 374 accctggcagggtcagtccatctct 398
           ||||||||||||||||| |||||||
Sbjct: 192 accctggcagggtcagtgcatctct 168

>dbj|AK087534.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130314P03 product:TATA box binding
           protein (Tbp)-associated factor, RNA polymerase I, C,
           full insert sequence
          Length = 3245

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 374 accctggcagggtcagtccatctct 398
           ||||||||||||||||| |||||||
Sbjct: 215 accctggcagggtcagtgcatctct 191

>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 210     cgtgcgcagctcggcggccgcgtcc 234
               ||||||||||||| |||||||||||
Sbjct: 3948872 cgtgcgcagctcgccggccgcgtcc 3948848

>dbj|AK030522.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length
           enriched library, clone:5330426I23 product:TATA box
           binding protein (Tbp)-associated factor, RNA polymerase
           I, C, full insert sequence
          Length = 3188

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 374 accctggcagggtcagtccatctct 398
           ||||||||||||||||| |||||||
Sbjct: 192 accctggcagggtcagtgcatctct 168

>ref|NM_021441.1| Mus musculus TATA box binding protein (Tbp)-associated factor, RNA
           polymerase I, C (Taf1c), mRNA
          Length = 3420

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 374 accctggcagggtcagtccatctct 398
           ||||||||||||||||| |||||||
Sbjct: 352 accctggcagggtcagtgcatctct 328

>emb|Y09974.1|MMTAFI95 M.musculus mRNA for TAFI95
          Length = 3420

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 374 accctggcagggtcagtccatctct 398
           ||||||||||||||||| |||||||
Sbjct: 352 accctggcagggtcagtgcatctct 328

>ref|XM_370524.1| Magnaporthe grisea 70-15 hypothetical protein (MG11078.4) partial
            mRNA
          Length = 1848

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 213  gcgcagctcggcggccgcgtccct 236
            ||||||||||||||||| ||||||
Sbjct: 1506 gcgcagctcggcggccgggtccct 1483

>emb|AL731718.30| Mouse DNA sequence from clone RP23-167O21 on chromosome 4, complete
             sequence
          Length = 133646

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 303   gcactccttggacggcagca 322
             ||||||||||||||||||||
Sbjct: 91870 gcactccttggacggcagca 91851

>gb|AC103834.2| Homo sapiens chromosome 8, clone RP11-1081K18, complete sequence
          Length = 173817

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 10     tagtaacattataaactgtataaa 33
              |||||||| |||||||||||||||
Sbjct: 107575 tagtaacaatataaactgtataaa 107552

>emb|AL954694.13| Zebrafish DNA sequence from clone CH211-219F7 in linkage group 5,
              complete sequence
          Length = 111431

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 18     ttataaactgtataaattag 37
              ||||||||||||||||||||
Sbjct: 109280 ttataaactgtataaattag 109299

>gb|BC062077.1| Rattus norvegicus similar to TAFI95, mRNA (cDNA clone
           IMAGE:5599601)
          Length = 4135

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 375 ccctggcagggtcagtccatctct 398
           |||||||||||||||| |||||||
Sbjct: 165 ccctggcagggtcagtgcatctct 142

>gb|BC061804.1| Rattus norvegicus similar to TAFI95, mRNA (cDNA clone MGC:72580
           IMAGE:5598458), complete cds
          Length = 3160

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 375 ccctggcagggtcagtccatctct 398
           |||||||||||||||| |||||||
Sbjct: 181 ccctggcagggtcagtgcatctct 158

>gb|AF169246.1|AF169246 Mus musculus transcription factor AML2/CBFA3 (Cbfa3) gene, partial
            cds
          Length = 5431

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 303  gcactccttggacggcagca 322
            ||||||||||||||||||||
Sbjct: 1763 gcactccttggacggcagca 1744

>ref|NM_001014155.1| Rattus norvegicus similar to TAFI95 (LOC361420), mRNA
          Length = 3160

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 375 ccctggcagggtcagtccatctct 398
           |||||||||||||||| |||||||
Sbjct: 181 ccctggcagggtcagtgcatctct 158

>emb|AL136338.4|CNS01DW5 Human chromosome 14 DNA sequence BAC C-2022M23 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 143177

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 149   gaagaaaaacccagtagccagcag 172
             ||||||||||||||||||| ||||
Sbjct: 49284 gaagaaaaacccagtagcctgcag 49307


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,973,956
Number of Sequences: 3902068
Number of extensions: 2973956
Number of successful extensions: 63077
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63023
Number of HSP's gapped (non-prelim): 54
length of query: 419
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 397
effective length of database: 17,147,199,772
effective search space: 6807438309484
effective search space used: 6807438309484
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)