ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl12f01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DQ404379.1| Haemophilus sp. COAD165 RecA (recA) gene, partial cds Length = 426 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 238 cagatgattcaggccagaaaattt 261 ||||||||||||||| |||||||| Sbjct: 97 cagatgattcaggcccgaaaattt 74
>gb|DQ404378.1| Haemophilus sp. COAD036 RecA (recA) gene, partial cds Length = 426 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 238 cagatgattcaggccagaaaattt 261 ||||||||||||||| |||||||| Sbjct: 97 cagatgattcaggcccgaaaattt 74
>gb|AY386264.1| Orf virus strain OV-SA00, complete genome Length = 139962 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 ttggacgcacagtctgtttt 46 |||||||||||||||||||| Sbjct: 78445 ttggacgcacagtctgtttt 78464
>gb|AY386263.1| Orf virus strain OV-IA82, complete genome Length = 137241 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 ttggacgcacagtctgtttt 46 |||||||||||||||||||| Sbjct: 77310 ttggacgcacagtctgtttt 77329
>emb|AJ585319.1| Haemophilus haemolyticus partial recA gene for recombinase A, strain HK676 Length = 447 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 238 cagatgattcaggccagaaaattt 261 ||||||||||||||| |||||||| Sbjct: 103 cagatgattcaggcccgaaaattt 80
>emb|AJ585318.1| Haemophilus haemolyticus partial recA gene for recombinase A, strain HK386 Length = 447 Score = 40.1 bits (20), Expect = 3.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 238 cagatgattcaggccagaaaattt 261 ||||||||||||||| |||||||| Sbjct: 103 cagatgattcaggcccgaaaattt 80
>gb|DQ184476.1| Orf virus strain NZ2, complete genome Length = 137820 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 27 ttggacgcacagtctgtttt 46 |||||||||||||||||||| Sbjct: 77682 ttggacgcacagtctgtttt 77701
>gb|AC090940.2| Homo sapiens chromosome 3 clone RP11-167P17 map 3p, complete sequence Length = 170293 Score = 40.1 bits (20), Expect = 3.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 34 cacagtctgttttgctagtt 53 |||||||||||||||||||| Sbjct: 73069 cacagtctgttttgctagtt 73050 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,632,334 Number of Sequences: 3902068 Number of extensions: 1632334 Number of successful extensions: 25202 Number of sequences better than 10.0: 8 Number of HSP's better than 10.0 without gapping: 8 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 25194 Number of HSP's gapped (non-prelim): 8 length of query: 295 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 273 effective length of database: 17,147,199,772 effective search space: 4681185537756 effective search space used: 4681185537756 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
