ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl12e03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 46 0.075
2gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 46 0.075
3gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 46 0.075
4gb|CP000001.1| Bacillus cereus E33L, complete genome 46 0.075
5gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 46 0.075
6emb|CR392026.10| Zebrafish DNA sequence from clone DKEY-153N9 in... 42 1.2
7gb|AC151789.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 40 4.6
8gb|AC005723.1| Homo sapiens chromosome 5, BAC clone 194j15 (LBNL... 40 4.6
9ref|NM_001012957.1| Homo sapiens disrupted in schizophrenia 1 (D... 40 4.6
10ref|NM_018662.2| Homo sapiens disrupted in schizophrenia 1 (DISC... 40 4.6
11gb|AC137603.16| Medicago truncatula clone mth2-14b10, complete s... 40 4.6
12emb|AL596109.6| Human DNA sequence from clone RP11-695D11 on chr... 40 4.6
13emb|AL445200.5| Human DNA sequence from clone RP5-852F22 on chro... 40 4.6
14emb|AL135911.16| Human DNA sequence from clone RP3-439I14 on chr... 40 4.6
15emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome 40 4.6
16gb|AC118480.3| Homo sapiens BAC clone RP11-393K13 from 4, comple... 40 4.6
17gb|AC027796.9| Homo sapiens chromosome 17, clone RP11-235E17, co... 40 4.6
18gb|AC087260.15| Homo sapiens 12p BAC RP11-437F6 (Roswell Park Ca... 40 4.6
19gb|AC008588.8| Homo sapiens chromosome 5 clone CTC-573M9, comple... 40 4.6
20gb|AC027691.13|AC027691 Homo sapiens chromosome 1 clone RP11-287... 40 4.6
21gb|AF222980.1|AF222980 Homo sapiens disrupted in Schizophrenia 1... 40 4.6
22gb|AC079115.7| Homo sapiens BAC clone RP11-102M8 from 2, complet... 40 4.6
23gb|AF168787.1|AF168787 Homo sapiens vanilloid receptor gene, par... 40 4.6
24emb|AJ336198.1|HSA336198 Homo sapiens genomic sequence surroundi... 40 4.6
25emb|CT485796.1| Medicago truncatula chromosome 5 clone mth2-154i... 40 4.6
26dbj|AB007926.1| Homo sapiens mRNA for KIAA0457 protein, partial cds 40 4.6

>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 29      ctctcttttttcctcaagttcat 51
               |||||||||||||||||||||||
Sbjct: 1243547 ctctcttttttcctcaagttcat 1243569



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 29      ctctcttttttcctcaagttcat 51
               |||||||||||||||||||||||
Sbjct: 1219683 ctctcttttttcctcaagttcat 1219705



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 29      ctctcttttttcctcaagttcat 51
               |||||||||||||||||||||||
Sbjct: 1219629 ctctcttttttcctcaagttcat 1219651



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 29      ctctcttttttcctcaagttcat 51
               |||||||||||||||||||||||
Sbjct: 1251492 ctctcttttttcctcaagttcat 1251514



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 29      ctctcttttttcctcaagttcat 51
               |||||||||||||||||||||||
Sbjct: 1219561 ctctcttttttcctcaagttcat 1219583



to top

>emb|CR392026.10| Zebrafish DNA sequence from clone DKEY-153N9 in linkage group 2, complete
              sequence
          Length = 191490

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 24     ttctcctctcttttttcctca 44
              |||||||||||||||||||||
Sbjct: 141831 ttctcctctcttttttcctca 141811



to top

>gb|AC151789.1| Ornithorhynchus anatinus chromosome UNK clone OABb-148A1, complete
              sequence
          Length = 125903

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 23     attctcctctcttttttcct 42
              ||||||||||||||||||||
Sbjct: 120366 attctcctctcttttttcct 120347



to top

>gb|AC005723.1| Homo sapiens chromosome 5, BAC clone 194j15 (LBNL H137) - BAC clone
             35G8 (LBNL H138) - BAC clone 194o13 (LBNL H106),  complete
             sequence
          Length = 127766

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    attctcctctcttttttcct 42
             ||||||||||||||||||||
Sbjct: 84448 attctcctctcttttttcct 84429



to top

>ref|NM_001012957.1| Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant
            Lv, mRNA
          Length = 7003

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  gcttctcttggggccacctt 194
            ||||||||||||||||||||
Sbjct: 4122 gcttctcttggggccacctt 4103



to top

>ref|NM_018662.2| Homo sapiens disrupted in schizophrenia 1 (DISC1), transcript variant
            L, mRNA
          Length = 7069

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  gcttctcttggggccacctt 194
            ||||||||||||||||||||
Sbjct: 4188 gcttctcttggggccacctt 4169



to top

>gb|AC137603.16| Medicago truncatula clone mth2-14b10, complete sequence
          Length = 109793

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 74    caaatgtcaggtttctacca 93
             ||||||||||||||||||||
Sbjct: 29616 caaatgtcaggtttctacca 29597



to top

>emb|AL596109.6| Human DNA sequence from clone RP11-695D11 on chromosome 1, complete
             sequence
          Length = 82965

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 23    attctcctctcttttttcct 42
             ||||||||||||||||||||
Sbjct: 10833 attctcctctcttttttcct 10814



to top

>emb|AL445200.5| Human DNA sequence from clone RP5-852F22 on chromosome 1 Contains the
             3' end of the DISC1 gene for disrupted in schizophrenia 1,
             complete sequence
          Length = 45435

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   gcttctcttggggccacctt 194
             ||||||||||||||||||||
Sbjct: 13712 gcttctcttggggccacctt 13693



to top

>emb|AL135911.16| Human DNA sequence from clone RP3-439I14 on chromosome 6q16.3-22.1
             Contains part of a novel gene, part of the gene for a
             novel protein similar to FLJ12457 (contains a 'Cold-shock'
             DNA-binding domain). Contains two CpG islands, complete
             sequence
          Length = 108907

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 24    ttctcctctcttttttcctc 43
             ||||||||||||||||||||
Sbjct: 34041 ttctcctctcttttttcctc 34060



to top

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 156     aactttgaacatccaatttgcttc 179
               ||||||||| ||||||||||||||
Sbjct: 2060494 aactttgaagatccaatttgcttc 2060471



to top

>gb|AC118480.3| Homo sapiens BAC clone RP11-393K13 from 4, complete sequence
          Length = 108490

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 318   atgttttcattcagggacca 337
             ||||||||||||||||||||
Sbjct: 58194 atgttttcattcagggacca 58175



to top

>gb|AC027796.9| Homo sapiens chromosome 17, clone RP11-235E17, complete sequence
          Length = 127431

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 37    tttcctcaagttcatacttt 56
             ||||||||||||||||||||
Sbjct: 29953 tttcctcaagttcatacttt 29972



to top

>gb|AC087260.15| Homo sapiens 12p BAC RP11-437F6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 174804

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 26     ctcctctcttttttcctcaagttc 49
              ||||||||||||||| ||||||||
Sbjct: 114332 ctcctctcttttttcttcaagttc 114355



to top

>gb|AC008588.8| Homo sapiens chromosome 5 clone CTC-573M9, complete sequence
          Length = 213167

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 23     attctcctctcttttttcct 42
              ||||||||||||||||||||
Sbjct: 117692 attctcctctcttttttcct 117673



to top

>gb|AC027691.13|AC027691 Homo sapiens chromosome 1 clone RP11-287O16, complete sequence
          Length = 175977

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    attctcctctcttttttcct 42
             ||||||||||||||||||||
Sbjct: 81149 attctcctctcttttttcct 81168



to top

>gb|AF222980.1|AF222980 Homo sapiens disrupted in Schizophrenia 1 protein (DISC1) mRNA,
            complete cds
          Length = 6930

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  gcttctcttggggccacctt 194
            ||||||||||||||||||||
Sbjct: 4188 gcttctcttggggccacctt 4169



to top

>gb|AC079115.7| Homo sapiens BAC clone RP11-102M8 from 2, complete sequence
          Length = 177285

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   acacaggtgaaagtgttagt 151
             ||||||||||||||||||||
Sbjct: 91906 acacaggtgaaagtgttagt 91925



to top

>gb|AF168787.1|AF168787 Homo sapiens vanilloid receptor gene, partial sequence; CARKL and CTNS
             genes, complete cds; TIP1 gene, partial cds; P2X5b and
             P2X5a genes, complete cds; and HUMINAE gene, partial cds
          Length = 200237

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    tttcctcaagttcatacttt 56
             ||||||||||||||||||||
Sbjct: 68279 tttcctcaagttcatacttt 68260



to top

>emb|AJ336198.1|HSA336198 Homo sapiens genomic sequence surrounding NotI site, clone
           HSJ-EJ1RS
          Length = 725

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 185 gggccaccttgggtcttcca 204
           ||||||||||||||||||||
Sbjct: 640 gggccaccttgggtcttcca 621



to top

>emb|CT485796.1| Medicago truncatula chromosome 5 clone mth2-154i23, COMPLETE SEQUENCE
          Length = 129047

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    cttttttcctcaagttcata 52
             ||||||||||||||||||||
Sbjct: 13604 cttttttcctcaagttcata 13623



to top

>dbj|AB007926.1| Homo sapiens mRNA for KIAA0457 protein, partial cds
          Length = 6833

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 175  gcttctcttggggccacctt 194
            ||||||||||||||||||||
Sbjct: 4108 gcttctcttggggccacctt 4089


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,251,475
Number of Sequences: 3902068
Number of extensions: 3251475
Number of successful extensions: 61212
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 61048
Number of HSP's gapped (non-prelim): 164
length of query: 348
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 326
effective length of database: 17,147,199,772
effective search space: 5589987125672
effective search space used: 5589987125672
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top