>dbj|AK015671.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4930500N06 product:hypothetical protein,
           full insert sequence
          Length = 847

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 104 acacgtccttaatacagagacaaaacct 131
           |||||||  |||||||||||||||||||
Sbjct: 219 acacgtcgataatacagagacaaaacct 246

>gb|AY109011.1| Zea mays PCO078615 mRNA sequence
          Length = 1368

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 172 tgcattccatatcaaagcaa 191
           ||||||||||||||||||||
Sbjct: 548 tgcattccatatcaaagcaa 529

>gb|AC132574.3| Mus musculus BAC clone RP24-421H8 from 1, complete sequence
          Length = 173036

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 234    caaacttcagctccacctgc 253
              ||||||||||||||||||||
Sbjct: 126753 caaacttcagctccacctgc 126772


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,917,305
Number of Sequences: 3902068
Number of extensions: 1917305
Number of successful extensions: 32208
Number of sequences better than 10.0: 3
Number of HSP's better than 10.0 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32205
Number of HSP's gapped (non-prelim): 3
length of query: 311
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 289
effective length of database: 17,147,199,772
effective search space: 4955540734108
effective search space used: 4955540734108
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)