>gb|AE017244.1| Mycoplasma hyopneumoniae 7448, complete genome
          Length = 920079

 Score = 38.2 bits (19), Expect = 0.90
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 2      aaacctctggttttttcgg 20
              |||||||||||||||||||
Sbjct: 226870 aaacctctggttttttcgg 226852



 Score = 38.2 bits (19), Expect = 0.90
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 2      aaacctctggttttttcgg 20
              |||||||||||||||||||
Sbjct: 140013 aaacctctggttttttcgg 140031

>gb|AE017243.1| Mycoplasma hyopneumoniae J, complete genome
          Length = 897405

 Score = 38.2 bits (19), Expect = 0.90
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 2      aaacctctggttttttcgg 20
              |||||||||||||||||||
Sbjct: 219462 aaacctctggttttttcgg 219444



 Score = 38.2 bits (19), Expect = 0.90
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 2      aaacctctggttttttcgg 20
              |||||||||||||||||||
Sbjct: 134697 aaacctctggttttttcgg 134715

>emb|X96932.1|NTASCOXRP N.tabacum gene encoding ascorbate oxidase-related protein
          Length = 6305

 Score = 38.2 bits (19), Expect = 0.90
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 7   tctggttttttcgggttgt 25
           |||||||||||||||||||
Sbjct: 976 tctggttttttcgggttgt 994

>gb|AE017332.1| Mycoplasma hyopneumoniae 232, complete genome
          Length = 892758

 Score = 38.2 bits (19), Expect = 0.90
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 2      aaacctctggttttttcgg 20
              |||||||||||||||||||
Sbjct: 307367 aaacctctggttttttcgg 307349



 Score = 38.2 bits (19), Expect = 0.90
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 2      aaacctctggttttttcgg 20
              |||||||||||||||||||
Sbjct: 222448 aaacctctggttttttcgg 222466

>gb|AF012905.1|AF012905 Mycoplasma hyopneumoniae cilium adhesin operon: cilium adhesin P97
            (P97) gene, partial cds, P102 (P102) gene, complete cds
            and alanyl-tRNA synthase (alaS) gene, partial cds
          Length = 4351

 Score = 38.2 bits (19), Expect = 0.90
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 2    aaacctctggttttttcgg 20
            |||||||||||||||||||
Sbjct: 1696 aaacctctggttttttcgg 1678

>ref|XM_719488.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY04304)
            partial mRNA
          Length = 5553

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 14   ttttcgggttgtcctgct 31
            ||||||||||||||||||
Sbjct: 1160 ttttcgggttgtcctgct 1143

>gb|AC073957.7| Homo sapiens BAC clone RP11-449P15 from 7, complete sequence
          Length = 196204

 Score = 36.2 bits (18), Expect = 3.5
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 12     ttttttcgggttgtcctgctgc 33
              |||||| |||||||||||||||
Sbjct: 189918 ttttttagggttgtcctgctgc 189897


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 233,619
Number of Sequences: 3902068
Number of extensions: 233619
Number of successful extensions: 54364
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54327
Number of HSP's gapped (non-prelim): 37
length of query: 36
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 16
effective length of database: 17,155,003,908
effective search space: 274480062528
effective search space used: 274480062528
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)