Clone Name | rbastl12b04 |
---|---|
Clone Library Name | barley_pub |
>gb|AC114589.30| Mus musculus chromosome 8, clone RP23-365O13, complete sequence Length = 213866 Score = 44.1 bits (22), Expect = 0.19 Identities = 22/22 (100%) Strand = Plus / Minus Query: 169 atccagaaactgcaaacaaagt 190 |||||||||||||||||||||| Sbjct: 143066 atccagaaactgcaaacaaagt 143045
>gb|AC112898.5| Rattus norvegicus 2 BAC CH230-157M2 (Children's Hospital Oakland Research Institute) complete sequence Length = 213379 Score = 42.1 bits (21), Expect = 0.75 Identities = 24/25 (96%) Strand = Plus / Minus Query: 167 atatccagaaactgcaaacaaagta 191 |||||||||||||| |||||||||| Sbjct: 175783 atatccagaaactggaaacaaagta 175759
>gb|AC161355.3| Mus musculus chromosome 1, clone RP24-149A24, complete sequence Length = 179242 Score = 42.1 bits (21), Expect = 0.75 Identities = 21/21 (100%) Strand = Plus / Minus Query: 167 atatccagaaactgcaaacaa 187 ||||||||||||||||||||| Sbjct: 52179 atatccagaaactgcaaacaa 52159
>gb|AC125161.3| Mus musculus BAC clone RP24-410I2 from chromosome 1, complete sequence Length = 142794 Score = 42.1 bits (21), Expect = 0.75 Identities = 21/21 (100%) Strand = Plus / Plus Query: 167 atatccagaaactgcaaacaa 187 ||||||||||||||||||||| Sbjct: 64065 atatccagaaactgcaaacaa 64085
>gb|AC163496.4| Mus musculus chromosome 1, clone RP24-325M15, complete sequence Length = 165387 Score = 42.1 bits (21), Expect = 0.75 Identities = 21/21 (100%) Strand = Plus / Plus Query: 167 atatccagaaactgcaaacaa 187 ||||||||||||||||||||| Sbjct: 25417 atatccagaaactgcaaacaa 25437
>gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence Length = 1590432 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 113 tcacatacagaatagcttgg 132 |||||||||||||||||||| Sbjct: 323073 tcacatacagaatagcttgg 323092
>gb|AC103580.4| Trypanosoma brucei chromosome 4 clone RPCI93-5E12, complete sequence Length = 174832 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 113 tcacatacagaatagcttgg 132 |||||||||||||||||||| Sbjct: 8822 tcacatacagaatagcttgg 8803
>gb|AC091702.3| Trypanosoma brucei chromosome 4 clone RPCI93-2L9, complete sequence Length = 161383 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 113 tcacatacagaatagcttgg 132 |||||||||||||||||||| Sbjct: 24377 tcacatacagaatagcttgg 24396 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,964,737 Number of Sequences: 3902068 Number of extensions: 1964737 Number of successful extensions: 34253 Number of sequences better than 10.0: 8 Number of HSP's better than 10.0 without gapping: 8 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 34242 Number of HSP's gapped (non-prelim): 11 length of query: 230 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 208 effective length of database: 17,147,199,772 effective search space: 3566617552576 effective search space used: 3566617552576 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)