ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl12b04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC114589.30| Mus musculus chromosome 8, clone RP23-365O13, co... 44 0.19
2gb|AC112898.5| Rattus norvegicus 2 BAC CH230-157M2 (Children's H... 42 0.75
3gb|AC161355.3| Mus musculus chromosome 1, clone RP24-149A24, com... 42 0.75
4gb|AC125161.3| Mus musculus BAC clone RP24-410I2 from chromosome... 42 0.75
5gb|AC163496.4| Mus musculus chromosome 1, clone RP24-325M15, com... 42 0.75
6gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence 40 2.9
7gb|AC103580.4| Trypanosoma brucei chromosome 4 clone RPCI93-5E12... 40 2.9
8gb|AC091702.3| Trypanosoma brucei chromosome 4 clone RPCI93-2L9,... 40 2.9

>gb|AC114589.30| Mus musculus chromosome 8, clone RP23-365O13, complete sequence
          Length = 213866

 Score = 44.1 bits (22), Expect = 0.19
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 169    atccagaaactgcaaacaaagt 190
              ||||||||||||||||||||||
Sbjct: 143066 atccagaaactgcaaacaaagt 143045



to top

>gb|AC112898.5| Rattus norvegicus 2 BAC CH230-157M2 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 213379

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 167    atatccagaaactgcaaacaaagta 191
              |||||||||||||| ||||||||||
Sbjct: 175783 atatccagaaactggaaacaaagta 175759



to top

>gb|AC161355.3| Mus musculus chromosome 1, clone RP24-149A24, complete sequence
          Length = 179242

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 167   atatccagaaactgcaaacaa 187
             |||||||||||||||||||||
Sbjct: 52179 atatccagaaactgcaaacaa 52159



to top

>gb|AC125161.3| Mus musculus BAC clone RP24-410I2 from chromosome 1, complete sequence
          Length = 142794

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 167   atatccagaaactgcaaacaa 187
             |||||||||||||||||||||
Sbjct: 64065 atatccagaaactgcaaacaa 64085



to top

>gb|AC163496.4| Mus musculus chromosome 1, clone RP24-325M15, complete sequence
          Length = 165387

 Score = 42.1 bits (21), Expect = 0.75
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 167   atatccagaaactgcaaacaa 187
             |||||||||||||||||||||
Sbjct: 25417 atatccagaaactgcaaacaa 25437



to top

>gb|CP000067.1| Trypanosoma brucei chromosome 4, complete sequence
          Length = 1590432

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 113    tcacatacagaatagcttgg 132
              ||||||||||||||||||||
Sbjct: 323073 tcacatacagaatagcttgg 323092



to top

>gb|AC103580.4| Trypanosoma brucei chromosome 4 clone RPCI93-5E12, complete sequence
          Length = 174832

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 113  tcacatacagaatagcttgg 132
            ||||||||||||||||||||
Sbjct: 8822 tcacatacagaatagcttgg 8803



to top

>gb|AC091702.3| Trypanosoma brucei chromosome 4 clone RPCI93-2L9, complete sequence
          Length = 161383

 Score = 40.1 bits (20), Expect = 2.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 113   tcacatacagaatagcttgg 132
             ||||||||||||||||||||
Sbjct: 24377 tcacatacagaatagcttgg 24396


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,964,737
Number of Sequences: 3902068
Number of extensions: 1964737
Number of successful extensions: 34253
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 34242
Number of HSP's gapped (non-prelim): 11
length of query: 230
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 208
effective length of database: 17,147,199,772
effective search space: 3566617552576
effective search space used: 3566617552576
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top