>gb|AC009516.19| Homo sapiens chromosome 22 clone p393 map 22q11, complete sequence
          Length = 169237

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 72    cttattgttcctgtgagtaatgaac 96
             ||||||||||||||||||| |||||
Sbjct: 69803 cttattgttcctgtgagtattgaac 69827

>gb|AC018751.30| Homo sapiens clone b9j16, complete sequence
          Length = 166447

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 72     cttattgttcctgtgagtaatgaac 96
              ||||||||||||||||||| |||||
Sbjct: 118065 cttattgttcctgtgagtattgaac 118041

>gb|AC154667.2| Mus musculus BAC clone RP23-153F8 from 16, complete sequence
          Length = 195017

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 72     cttattgttcctgtgagtaatgaac 96
              ||||||||||||||||||| |||||
Sbjct: 146040 cttattgttcctgtgagtattgaac 146016

>gb|U57900.1|TTU57900 Thauera aromatica utilizing regulatory protein tutC (tutC), utilizing
            regulatory protein tutB (tutB), putative DNA binding
            protein TutB1 (tutB1), and putative protein kinase TutC1
            (tutC1) genes, complete cds
          Length = 8532

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 2    acaaaatccagccgtccaaatttgt 26
            |||||||| ||||||||||||||||
Sbjct: 2749 acaaaatcaagccgtccaaatttgt 2725

>dbj|AP000558.1| Homo sapiens genomic DNA, chromosome 22q11.2, BCRL2 region,
             clone:KB1802C5
          Length = 48700

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 72    cttattgttcctgtgagtaatgaac 96
             ||||||||||||||||||| |||||
Sbjct: 34751 cttattgttcctgtgagtattgaac 34775

>gb|AC151776.1| Ornithorhynchus anatinus chromosome UNK clone OABb-272A1, complete
             sequence
          Length = 126974

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 167   agctggacaattggtccagc 186
             ||||||||||||||||||||
Sbjct: 17488 agctggacaattggtccagc 17507

>gb|AC009638.9| Homo sapiens chromosome 11, clone RP11-47K5, complete sequence
          Length = 157610

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    cttattgttcctgtgagtaa 91
             ||||||||||||||||||||
Sbjct: 51106 cttattgttcctgtgagtaa 51087

>emb|BX255950.7| Zebrafish DNA sequence from clone CH211-250K6 in linkage group 5,
            complete sequence
          Length = 151104

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 146  tatatacagagattacaagc 165
            ||||||||||||||||||||
Sbjct: 6334 tatatacagagattacaagc 6315

>gb|AC146130.4| Pan troglodytes BAC clone RP43-4F10 from chromosome 7, complete
             sequence
          Length = 204322

 Score = 40.1 bits (20), Expect = 4.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 314   gaatcacctagggccggctgcaaa 337
             ||||||||||| ||||||||||||
Sbjct: 61536 gaatcacctagtgccggctgcaaa 61513


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,458,487
Number of Sequences: 3902068
Number of extensions: 2458487
Number of successful extensions: 41734
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41717
Number of HSP's gapped (non-prelim): 17
length of query: 353
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 331
effective length of database: 17,147,199,772
effective search space: 5675723124532
effective search space used: 5675723124532
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)