Clone Name | rbastl11h08 |
---|---|
Clone Library Name | barley_pub |
>emb|BX530015.9| Zebrafish DNA sequence from clone DKEY-262K23 in linkage group 11, complete sequence Length = 101327 Score = 44.1 bits (22), Expect = 0.26 Identities = 22/22 (100%) Strand = Plus / Minus Query: 12 gtattcacatgaactcaatata 33 |||||||||||||||||||||| Sbjct: 6984 gtattcacatgaactcaatata 6963
>ref|XM_640137.1| Dictyostelium discoideum hypothetical protein (DDB0168743), partial mRNA Length = 1845 Score = 42.1 bits (21), Expect = 1.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 121 acatgatacttcatttgaggaatgg 145 ||||||||||||||| ||||||||| Sbjct: 1434 acatgatacttcattggaggaatgg 1458
>gb|AC116963.2| Dictyostelium discoideum chromosome 2 map 4657875-4914984 strain AX4, complete sequence Length = 257109 Score = 42.1 bits (21), Expect = 1.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 121 acatgatacttcatttgaggaatgg 145 ||||||||||||||| ||||||||| Sbjct: 20164 acatgatacttcattggaggaatgg 20140
>gb|AC114998.13| Mus musculus chromosome 8, clone RP23-476P11, complete sequence Length = 222621 Score = 42.1 bits (21), Expect = 1.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 208 tgttgaaggaagtgtgttgaa 228 ||||||||||||||||||||| Sbjct: 146953 tgttgaaggaagtgtgttgaa 146933
>gb|AY747307.1| Nosema spodopterae large subunit ribosomal RNA gene, internal transcribed spacer, small subunit ribosomal RNA gene, intergenic spacer , and 5S ribosomal RNA gene, complete sequence Length = 4446 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 207 ctgttgaaggaagtgtgttg 226 |||||||||||||||||||| Sbjct: 4333 ctgttgaaggaagtgtgttg 4314
>emb|AL445423.13| Human DNA sequence from clone RP11-295M18 on chromosome 1 Contains the 3' end of a novel gene (FLJ22390), two novel genes, the HLX1 gene for H2.0-like homeo box 1 (Drosophila) and four CpG islands, complete sequence Length = 177941 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 152 gagttctaggggcatcactt 171 |||||||||||||||||||| Sbjct: 173629 gagttctaggggcatcactt 173648
>emb|AL391992.8| Human DNA sequence from clone RP11-2N7 on chromosome 10, complete sequence Length = 97655 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 aactacagaaatcataagaa 204 |||||||||||||||||||| Sbjct: 18472 aactacagaaatcataagaa 18453
>emb|AL121977.11|HSJ492P14 Human DNA sequence from clone RP3-492P14 on chromosome 6q13-15 Contains a single stranded DNA binding protein pseudogene, the TPBG gene for trophoblast glycoprotein (5T4-AG) and a CpG island, complete sequence Length = 121909 Score = 40.1 bits (20), Expect = 4.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 127 tacttcatttgaggaatggaatgctgag 154 ||||||||||| ||||||||| |||||| Sbjct: 116414 tacttcatttgtggaatggaaagctgag 116387
>gb|AC094527.7| Rattus norvegicus 5 BAC CH230-4L11 (Children's Hospital Oakland Research Institute) complete sequence Length = 216616 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 97 agaagcaagtaacactgaca 116 |||||||||||||||||||| Sbjct: 73604 agaagcaagtaacactgaca 73623
>gb|AC023886.7| Homo sapiens BAC clone RP11-402J6 from 4, complete sequence Length = 179697 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 102 caagtaacactgacagaaaa 121 |||||||||||||||||||| Sbjct: 129643 caagtaacactgacagaaaa 129662
>tpg|BK000438.1| TPA: TPA_exp: Homo sapiens RING finger protein COP1 gene, complete cds Length = 421987 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 223 gttgaaatgaatcatcacat 242 |||||||||||||||||||| Sbjct: 257697 gttgaaatgaatcatcacat 257678
>gb|AC005966.2|T2K10 Arabidopsis thaliana chromosome 1 BAC T2K10 sequence, complete sequence Length = 90284 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 215 ggaagtgtgttgaaatgaat 234 |||||||||||||||||||| Sbjct: 83252 ggaagtgtgttgaaatgaat 83233
>emb|AL590723.13| Human DNA sequence from clone RP11-492I21 on chromosome 1 Contains part of the gene for constitutive photomorphogenic protein (COP1) and a novel gene, complete sequence Length = 178223 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 223 gttgaaatgaatcatcacat 242 |||||||||||||||||||| Sbjct: 84873 gttgaaatgaatcatcacat 84892
>emb|AJ420536.1|HSA420536 Homo sapiens mRNA full length insert cDNA clone EUROIMAGE 994183 Length = 1597 Score = 40.1 bits (20), Expect = 4.1 Identities = 26/28 (92%) Strand = Plus / Minus Query: 127 tacttcatttgaggaatggaatgctgag 154 ||||||||||| ||||||||| |||||| Sbjct: 1152 tacttcatttgtggaatggaaagctgag 1125
>emb|X55021.1|EHVSAB E.histolytica mRNA for nonpathogenic immuno-dominant variable surface antigen Length = 1410 Score = 40.1 bits (20), Expect = 4.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 225 tgaaatgaatcatcacatgc 244 |||||||||||||||||||| Sbjct: 150 tgaaatgaatcatcacatgc 169 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,717,472 Number of Sequences: 3902068 Number of extensions: 2717472 Number of successful extensions: 47200 Number of sequences better than 10.0: 15 Number of HSP's better than 10.0 without gapping: 15 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 47182 Number of HSP's gapped (non-prelim): 18 length of query: 309 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 287 effective length of database: 17,147,199,772 effective search space: 4921246334564 effective search space used: 4921246334564 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)