>gb|CP000114.1| Streptococcus agalactiae A909, complete genome
          Length = 2127839

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 69      acagataggagaattctcca 88
               ||||||||||||||||||||
Sbjct: 1920245 acagataggagaattctcca 1920226

>emb|Z95152.1|HS179N16 Human DNA sequence from clone RP1-179N16 on chromosome 6p21.1-21.33
              Contains the MAPK13 and  MAPK14 genes for mitogen-activated
              protein kinase 13 and 14 , a nudix type 5 motif (nudt5)
              pseudogene, the 5' end of the SLC26A8 gene for solute
              carrier family 26 member 8 and two CpG islands, complete
              sequence
          Length = 172048

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 55     aattcagtgtaactacagat 74
              ||||||||||||||||||||
Sbjct: 122066 aattcagtgtaactacagat 122047

>gb|AC118627.6| Mus musculus chromosome 15, clone RP24-91E8, complete sequence
          Length = 256158

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     ggataacatctgtgaacaa 56
              |||||||||||||||||||
Sbjct: 232048 ggataacatctgtgaacaa 232066

>ref|XM_876275.1| PREDICTED: Bos taurus similar to tripartite motif-containing 41
            isform 1, transcript variant 6 (LOC540265), mRNA
          Length = 1967

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 85   tccatcatgtcgaccattc 103
            |||||||||||||||||||
Sbjct: 1599 tccatcatgtcgaccattc 1581

>ref|XM_876018.1| PREDICTED: Bos taurus similar to tripartite motif-containing 41
            isform 1, transcript variant 3 (LOC540265), mRNA
          Length = 1786

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 85   tccatcatgtcgaccattc 103
            |||||||||||||||||||
Sbjct: 1418 tccatcatgtcgaccattc 1400

>ref|XM_865387.1| PREDICTED: Bos taurus similar to tripartite motif-containing 41
            isform 1, transcript variant 2 (LOC540265), mRNA
          Length = 2869

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 85   tccatcatgtcgaccattc 103
            |||||||||||||||||||
Sbjct: 2501 tccatcatgtcgaccattc 2483

>gb|AC154704.2| Mus musculus BAC clone RP24-349I24 from chromosome 9, complete sequence
          Length = 188875

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 52    aacaattcagtgtaactac 70
             |||||||||||||||||||
Sbjct: 94885 aacaattcagtgtaactac 94903

>gb|AC116769.11| Mus musculus chromosome 15, clone RP23-415L16, complete sequence
          Length = 201535

 Score = 38.2 bits (19), Expect = 6.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 38     ggataacatctgtgaacaa 56
              |||||||||||||||||||
Sbjct: 180198 ggataacatctgtgaacaa 180180


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,366,257
Number of Sequences: 3902068
Number of extensions: 1366257
Number of successful extensions: 95898
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 95868
Number of HSP's gapped (non-prelim): 30
length of query: 141
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 120
effective length of database: 17,151,101,840
effective search space: 2058132220800
effective search space used: 2058132220800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)