Clone Name | rbastl11f12 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_992631.1| PREDICTED: Mus musculus dynein, axonemal, heavy chain 2 (Dnahc2), mRNA Length = 13273 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 103 tagagcaaccactgctgctga 123 ||||||||||||||||||||| Sbjct: 2291 tagagcaaccactgctgctga 2271
>ref|XM_908804.2| PREDICTED: Mus musculus dynein, axonemal, heavy chain 2 (Dnahc2), mRNA Length = 13771 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 103 tagagcaaccactgctgctga 123 ||||||||||||||||||||| Sbjct: 2774 tagagcaaccactgctgctga 2754
>ref|XM_894696.2| PREDICTED: Mus musculus dynein heavy chain domain 3, transcript variant 2 (Dnhd3), mRNA Length = 13704 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 103 tagagcaaccactgctgctga 123 ||||||||||||||||||||| Sbjct: 2707 tagagcaaccactgctgctga 2687
>emb|AL596125.27| Mouse DNA sequence from clone RP23-5O23 on chromosome 11 Contains the Chd3 gene for chromodomain helicase DNA binding protein 3, five novel genes, the 3' end of the gene for a novel protein similar to dynein and four CpG islands, complete sequence Length = 165212 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Plus Query: 103 tagagcaaccactgctgctga 123 ||||||||||||||||||||| Sbjct: 155319 tagagcaaccactgctgctga 155339
>gb|DQ369995.1| HIV-1 isolate 02ZAPS015MB1 from South Africa, complete genome Length = 9028 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 293 ccttcctcttgtgcttccaac 313 ||||||||||||||||||||| Sbjct: 8396 ccttcctcttgtgcttccaac 8376
>gb|AY903244.1| Rattus norvegicus strain BN/Cub dynein axonemal heavy chain-like protein mRNA, partial cds Length = 11994 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 103 tagagcaaccactgctgctga 123 ||||||||||||||||||||| Sbjct: 1085 tagagcaaccactgctgctga 1065
>gb|AY903243.1| Rattus norvegicus strain SHR/OlaIpcv dynein axonemal heavy chain-like protein mRNA, partial cds Length = 11994 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 103 tagagcaaccactgctgctga 123 ||||||||||||||||||||| Sbjct: 1085 tagagcaaccactgctgctga 1065
>gb|AY903242.1| Rattus norvegicus strain WHD dynein axonemal heavy chain-like protein mRNA, partial cds Length = 11994 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 103 tagagcaaccactgctgctga 123 ||||||||||||||||||||| Sbjct: 1085 tagagcaaccactgctgctga 1065
>ref|XM_220603.3| PREDICTED: Rattus norvegicus dynein-like protein 2 (DLP2), mRNA Length = 14742 Score = 42.1 bits (21), Expect = 1.4 Identities = 21/21 (100%) Strand = Plus / Minus Query: 103 tagagcaaccactgctgctga 123 ||||||||||||||||||||| Sbjct: 3512 tagagcaaccactgctgctga 3492
>gb|AC146546.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0062M03 map near S6115, complete sequence Length = 138223 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 223 aaagcatagctcatgtacac 242 |||||||||||||||||||| Sbjct: 64929 aaagcatagctcatgtacac 64948
>gb|AC150753.3| Bos taurus BAC CH240-283G19 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 181464 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 87 ggagcccacaacactctaga 106 |||||||||||||||||||| Sbjct: 42827 ggagcccacaacactctaga 42846
>gb|AY322190.1| HIV-1 isolate ML605-3-1997 from Kenya, complete genome Length = 9164 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 cttcctcttgtgcttccaac 313 |||||||||||||||||||| Sbjct: 8511 cttcctcttgtgcttccaac 8492
>gb|AY371131.1| HIV-1 isolate 01CM.0074NY from Cameroon gag protein (gag) and pol protein (pol) genes, partial cds; vif protein (vif), vpr protein (vpr), tat protein (tat), rev protein (rev), vpu protein (vpu), and envelope glycoprotein (env) genes, complete cds; and nef protein (nef) gene, partial cds Length = 8405 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 292 cccttcctcttgtgcttcca 311 |||||||||||||||||||| Sbjct: 8203 cccttcctcttgtgcttcca 8184
>gb|AY371129.1| HIV-1 isolate 02CM.2162SA from Cameroon gag protein (gag) and pol protein (pol) genes, partial cds; vif protein (vif), vpr protein (vpr), tat protein (tat), rev protein (rev), vpu protein (vpu), and envelope glycoprotein (env) genes, complete cds; and nef protein (nef) gene, partial cds Length = 8440 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 cttcctcttgtgcttccaac 313 |||||||||||||||||||| Sbjct: 8236 cttcctcttgtgcttccaac 8217
>gb|AC020606.7| Homo sapiens BAC clone RP11-563O5 from 7, complete sequence Length = 151822 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 22 tttttcccatggcattcagagaga 45 |||||||| ||||||||||||||| Sbjct: 112778 tttttcccctggcattcagagaga 112801
>gb|AC146090.2| Pan troglodytes BAC clone RP43-47O15 from 7, complete sequence Length = 189400 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 22 tttttcccatggcattcagagaga 45 |||||||| ||||||||||||||| Sbjct: 94012 tttttcccctggcattcagagaga 93989
>emb|AL590427.15| Human DNA sequence from clone RP11-396N10 on chromosome 1 Contains the 5' end of the NTNG1 gene for netrin G1 and a CpG island, complete sequence Length = 160135 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 346 ggtcctcggggtcctctccc 365 |||||||||||||||||||| Sbjct: 8729 ggtcctcggggtcctctccc 8748
>gb|AF408626.1| HIV-1 isolate A025 from Argentina, complete genome Length = 8937 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 292 cccttcctcttgtgcttcca 311 |||||||||||||||||||| Sbjct: 8372 cccttcctcttgtgcttcca 8353
>ref|XM_943530.1| PREDICTED: Homo sapiens hypothetical protein LOC648974 (LOC648974), mRNA Length = 1149 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 346 ggtcctcggggtcctctccc 365 |||||||||||||||||||| Sbjct: 135 ggtcctcggggtcctctccc 116
>gb|AY265093.1| HIV-1 isolate 98CM1436 from Cameroon nef protein (nef) gene, complete cds Length = 621 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 cttcctcttgtgcttccaac 313 |||||||||||||||||||| Sbjct: 190 cttcctcttgtgcttccaac 171
>gb|AY265064.1| HIV-1 isolate 98CM9835 from Cameroon nef protein (nef) gene, complete cds Length = 639 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 292 cccttcctcttgtgcttcca 311 |||||||||||||||||||| Sbjct: 207 cccttcctcttgtgcttcca 188
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 223 aaagcatagctcatgtacac 242 |||||||||||||||||||| Sbjct: 12208253 aaagcatagctcatgtacac 12208272
>gb|AC157483.2| Pan troglodytes BAC clone CH251-287G22 from chromosome unknown, complete sequence Length = 163028 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 22 tttttcccatggcattcagagaga 45 |||||||| ||||||||||||||| Sbjct: 94022 tttttcccctggcattcagagaga 93999
>gb|AY781128.1| HIV-1 isolate 01UYTRA1020 from Uruguay, complete genome Length = 8801 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 292 cccttcctcttgtgcttcca 311 |||||||||||||||||||| Sbjct: 8186 cccttcctcttgtgcttcca 8167
>gb|AF195771.1|AF195771 Streptomyces albus SsgA (ssgA) gene, complete cds Length = 566 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 381 aaggcgagctcctcggagac 400 |||||||||||||||||||| Sbjct: 57 aaggcgagctcctcggagac 38
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 324 tgcagctcgccgacgcacca 343 |||||||||||||||||||| Sbjct: 1167414 tgcagctcgccgacgcacca 1167395
>dbj|AP005269.1| Pan troglodytes DNA, chromosome 7 clone:PTB-102E09, complete sequence Length = 172438 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 22 tttttcccatggcattcagagaga 45 |||||||| ||||||||||||||| Sbjct: 12943 tttttcccctggcattcagagaga 12920
>gb|AY899368.1| HIV-1 isolate 04MHI10-1730 from South Korea nef protein (nef) gene, complete cds Length = 663 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 cttcctcttgtgcttccaac 313 |||||||||||||||||||| Sbjct: 190 cttcctcttgtgcttccaac 171
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 223 aaagcatagctcatgtacac 242 |||||||||||||||||||| Sbjct: 12287560 aaagcatagctcatgtacac 12287579
>gb|AY037275.1| HIV-1 isolate ARMA036 from Argentina gag protein (gag) and pol protein (pol) genes, partial cds; vif protein (vif), vpr protein (vpr), tat protein (tat), rev protein (rev), vpu protein (vpu), envelope glycoprotein (env), and nef protein (nef) genes, complete cds; and long terminal repeat, complete sequence Length = 8675 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 cttcctcttgtgcttccaac 313 |||||||||||||||||||| Sbjct: 8244 cttcctcttgtgcttccaac 8225 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,272,107 Number of Sequences: 3902068 Number of extensions: 3272107 Number of successful extensions: 63418 Number of sequences better than 10.0: 30 Number of HSP's better than 10.0 without gapping: 30 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 63324 Number of HSP's gapped (non-prelim): 94 length of query: 418 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 396 effective length of database: 17,147,199,772 effective search space: 6790291109712 effective search space used: 6790291109712 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)