>ref|XM_451611.1| Kluyveromyces lactis NRRL Y-1140, KLLA0B01804g predicted mRNA
          Length = 9729

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 3    aaatgcgatgtgcctaaaggaaat 26
            ||||||||| ||||||||||||||
Sbjct: 1545 aaatgcgatttgcctaaaggaaat 1522

>emb|AL357515.26| Human DNA sequence from clone RP11-397G5 on chromosome 6 Contains the 3'
              end of the AMD1 gene for S-adenosylmethionine decarboxylase
              1, two novel genes, a glutathione S-transferase M2 (muscle)
              (GSTM2) pseudogene and three CpG islands, complete sequence
          Length = 190440

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     taaccaatcactccacattt 90
              ||||||||||||||||||||
Sbjct: 140419 taaccaatcactccacattt 140438

>emb|CR382122.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 1320834

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 3      aaatgcgatgtgcctaaaggaaat 26
              ||||||||| ||||||||||||||
Sbjct: 145767 aaatgcgatttgcctaaaggaaat 145744

>gb|AC092981.3| Homo sapiens 3 BAC RP11-305I9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 160000

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 75    caatcactccacattttcc 93
             |||||||||||||||||||
Sbjct: 38837 caatcactccacattttcc 38819

>ref|NM_142332.1| Drosophila melanogaster CG18213-RA (CG18213), mRNA
          Length = 3000

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 5   atgcgatgtgcctaaagga 23
           |||||||||||||||||||
Sbjct: 837 atgcgatgtgcctaaagga 855

>gb|AC060788.11| Homo sapiens chromosome 8, clone CTD-2008O4, complete sequence
          Length = 177717

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 4     aatgcgatgtgcctaaaggaaat 26
             |||||||||||| ||||||||||
Sbjct: 66462 aatgcgatgtgcataaaggaaat 66440

>gb|AC007807.8|AC007807 Drosophila melanogaster, chromosome 3R, region 89E-89E, BAC clone
             BACR01E04, complete sequence
          Length = 172674

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     atgcgatgtgcctaaagga 23
             |||||||||||||||||||
Sbjct: 24146 atgcgatgtgcctaaagga 24128

>gb|AC091636.1|AC091636 Drosophila melanogaster, chromosome 3R, region 89E-89E, BAC clone
              BACR03M20, complete sequence
          Length = 175335

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 5      atgcgatgtgcctaaagga 23
              |||||||||||||||||||
Sbjct: 143999 atgcgatgtgcctaaagga 143981

>gb|AF216527.1|AF216527 Dunaliella tertiolecta calcium-dependent protein kinase mRNA,
            complete cds
          Length = 2532

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 72   aaccaatcactccacattt 90
            |||||||||||||||||||
Sbjct: 2040 aaccaatcactccacattt 2022

>gb|BT003585.1| Drosophila melanogaster LD11102 full insert cDNA
          Length = 3227

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 5   atgcgatgtgcctaaagga 23
           |||||||||||||||||||
Sbjct: 920 atgcgatgtgcctaaagga 938

>gb|AE003716.5| Drosophila melanogaster chromosome 3R, section 54 of 118 of the
             complete sequence
          Length = 220035

 Score = 38.2 bits (19), Expect = 4.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     atgcgatgtgcctaaagga 23
             |||||||||||||||||||
Sbjct: 10721 atgcgatgtgcctaaagga 10703


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 635,033
Number of Sequences: 3902068
Number of extensions: 635033
Number of successful extensions: 36883
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 36864
Number of HSP's gapped (non-prelim): 19
length of query: 99
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 78
effective length of database: 17,151,101,840
effective search space: 1337785943520
effective search space used: 1337785943520
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)