>gb|AC069286.7| Homo sapiens BAC clone RP11-261N10 from 7, complete sequence
          Length = 157118

 Score = 42.1 bits (21), Expect = 0.77
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 197    aggcttcatggcgtagaggatagacagga 225
              ||||||||||| |||||||| ||||||||
Sbjct: 109648 aggcttcatggtgtagaggaaagacagga 109620

>gb|AC124399.4| Mus musculus BAC clone RP24-351I17 from chromosome 10, complete
             sequence
          Length = 179668

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   tgctctgcagaggctgaggc 144
             ||||||||||||||||||||
Sbjct: 48266 tgctctgcagaggctgaggc 48285

>ref|XM_858047.1| PREDICTED: Canis familiaris similar to CG31120-PA, isoform A,
           transcript variant 2 (LOC478122), mRNA
          Length = 1154

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 137 gctgaggcgttggaagaccg 156
           ||||||||||||||||||||
Sbjct: 835 gctgaggcgttggaagaccg 854

>ref|XM_535297.2| PREDICTED: Canis familiaris similar to CG31120-PA, isoform A,
            transcript variant 1 (LOC478122), mRNA
          Length = 1647

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 137  gctgaggcgttggaagaccg 156
            ||||||||||||||||||||
Sbjct: 1328 gctgaggcgttggaagaccg 1347

>gb|CP000302.1| Shewanella denitrificans OS217, complete genome
          Length = 4545906

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 188     aatatcgctaggcttcatgg 207
               ||||||||||||||||||||
Sbjct: 4138831 aatatcgctaggcttcatgg 4138850

>gb|AC153499.7| Mus musculus 10 BAC RP23-478J15 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207222

 Score = 40.1 bits (20), Expect = 3.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 125    tgctctgcagaggctgaggc 144
              ||||||||||||||||||||
Sbjct: 205137 tgctctgcagaggctgaggc 205156


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,724,568
Number of Sequences: 3902068
Number of extensions: 2724568
Number of successful extensions: 29871
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29860
Number of HSP's gapped (non-prelim): 11
length of query: 237
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 215
effective length of database: 17,147,199,772
effective search space: 3686647950980
effective search space used: 3686647950980
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)