ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl11a11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC020728.4|AC020728 Homo sapiens BAC clone RP11-506H20 from 5... 48 0.017
2emb|AL138836.15| Human DNA sequence from clone RP11-88M19 on chr... 44 0.26
3gb|AC115097.6| Homo sapiens chromosome 11, clone CTD-2532J14, co... 42 1.0
4gb|AC024293.18| Homo sapiens chromosome 11, clone RP11-425L10, c... 42 1.0
5dbj|AK025353.1| Homo sapiens cDNA: FLJ21700 fis, clone COL09849,... 42 1.0
6ref|XM_514594.1| PREDICTED: Pan troglodytes similar to Adenosylh... 40 4.1
7gb|BC010018.2| Homo sapiens S-adenosylhomocysteine hydrolase, mR... 40 4.1
8gb|AC145615.3| Homo sapiens BAC clone RP11-1217H2 from UL, compl... 40 4.1
9gb|AC113454.8| Mus musculus chromosome 3, clone RP24-176I19, com... 40 4.1
10gb|BC114924.1| Homo sapiens hypothetical protein FLJ20245, mRNA ... 40 4.1
11emb|AL356299.16| Human DNA sequence from clone CTD-3216D2 on chr... 40 4.1
12gb|AC141587.2| Homo sapiens chromosome 16 clone RP11-1046E19, co... 40 4.1
13gb|BT007625.1| Synthetic construct Homo sapiens S-adenosylhomocy... 40 4.1
14gb|BT006697.1| Homo sapiens S-adenosylhomocysteine hydrolase mRN... 40 4.1
15dbj|AK097610.1| Homo sapiens cDNA FLJ40291 fis, clone TESTI20283... 40 4.1
16gb|AC182397.3| Pan troglodytes BAC clone CH251-345O12 from chrom... 40 4.1
17emb|CR603449.1| full-length cDNA clone CS0DG007YH14 of B cells (... 40 4.1
18emb|CR594678.1| full-length cDNA clone CS0DL004YE09 of B cells (... 40 4.1
19gb|AC007028.3| Homo sapiens chromosome 16 clone RP5-835P2, compl... 40 4.1
20ref|NM_000687.1| Homo sapiens S-adenosylhomocysteine hydrolase (... 40 4.1
21dbj|AB169648.1| Macaca fascicularis brain cDNA, clone: QccE-1226... 40 4.1
22gb|BC105194.1| Bos taurus S-adenosylhomocysteine hydrolase, mRNA... 40 4.1
23gb|AC141248.2| Homo sapiens chromosome 16 clone RP11-1251B5, com... 40 4.1
24gb|AC140890.2| Homo sapiens chromosome 16 clone RP11-188D24, com... 40 4.1
25gb|AC004902.2|AC004902 Homo sapiens PAC clone RP5-823F17 from 7q... 40 4.1
26gb|AC013734.4|AC013734 Homo sapiens BAC clone RP11-557B9 from Y,... 40 4.1
27gb|AC136428.3| Homo sapiens chromosome 16 clone RP11-104C4, comp... 40 4.1
28gb|AY892700.1| Synthetic construct Homo sapiens clone FLH024356.... 40 4.1
29gb|AY890211.1| Synthetic construct Homo sapiens clone FLH024359.... 40 4.1
30emb|AL928960.25| Mouse DNA sequence from clone RP23-413K16 on ch... 40 4.1
31gb|BC011606.2| Homo sapiens S-adenosylhomocysteine hydrolase, mR... 40 4.1
32dbj|AP000974.5| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 4.1
33ref|NM_001034315.1| Bos taurus S-adenosylhomocysteine hydrolase ... 40 4.1
34gb|M61832.1|HUMAHCY2 Human S-adenosylhomocysteine hydrolase (AHC... 40 4.1
35gb|M61831.1|HUMAHCY Human S-adenosylhomocysteine hydrolase (AHCY... 40 4.1

>gb|AC020728.4|AC020728 Homo sapiens BAC clone RP11-506H20 from 5, complete sequence
          Length = 201404

 Score = 48.1 bits (24), Expect = 0.017
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 148    ttgccaagatgaatcctacttttaaaac 175
              |||||||||||| |||||||||||||||
Sbjct: 146381 ttgccaagatgactcctacttttaaaac 146408



to top

>emb|AL138836.15| Human DNA sequence from clone RP11-88M19 on chromosome 9 Contains the 5'
              end of the CDK5RAP2 gene for CDK5 regulatory subunit
              associated protein 2 (C48), the EGFL5 gene for
              EGF-like-domain, multiple 5 (MEGF9), an
              S-adenosylhomocysteine hydrolase (AHCY) pseudogene, the 3'
              end of a variant of the FBXW2 gene for  F-box and WD-40
              domain protein 2 (FBW2) and a CpG island, complete sequence
          Length = 188481

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 53     ttaccaacctcatccacaccaa 74
              ||||||||||||||||||||||
Sbjct: 151552 ttaccaacctcatccacaccaa 151573



to top

>gb|AC115097.6| Homo sapiens chromosome 11, clone CTD-2532J14, complete sequence
          Length = 132923

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 283 agcaccatgcacaaaaccaca 303
           |||||||||||||||||||||
Sbjct: 486 agcaccatgcacaaaaccaca 506



to top

>gb|AC024293.18| Homo sapiens chromosome 11, clone RP11-425L10, complete sequence
          Length = 70106

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 283   agcaccatgcacaaaaccaca 303
             |||||||||||||||||||||
Sbjct: 48638 agcaccatgcacaaaaccaca 48658



to top

>dbj|AK025353.1| Homo sapiens cDNA: FLJ21700 fis, clone COL09849, highly similar to
            HSU14972 Human ribosomal protein S10 mRNA
          Length = 3194

 Score = 42.1 bits (21), Expect = 1.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 283  agcaccatgcacaaaaccaca 303
            |||||||||||||||||||||
Sbjct: 1475 agcaccatgcacaaaaccaca 1455



to top

>ref|XM_514594.1| PREDICTED: Pan troglodytes similar to Adenosylhomocysteinase
           (S-adenosyl-L-homocysteine hydrolase) (AdoHcyase)
           (LOC458190), mRNA
          Length = 2249

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 446 accaacctcatccacaccaa 465



to top

>gb|BC010018.2| Homo sapiens S-adenosylhomocysteine hydrolase, mRNA (cDNA clone
           MGC:19639 IMAGE:2905378), complete cds
          Length = 2166

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 475 accaacctcatccacaccaa 494



to top

>gb|AC145615.3| Homo sapiens BAC clone RP11-1217H2 from UL, complete sequence
          Length = 207889

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 36     ttggatacaatagcaattta 55
              ||||||||||||||||||||
Sbjct: 175402 ttggatacaatagcaattta 175383



to top

>gb|AC113454.8| Mus musculus chromosome 3, clone RP24-176I19, complete sequence
          Length = 171480

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 286   accatgcacaaaaccacatg 305
             ||||||||||||||||||||
Sbjct: 20369 accatgcacaaaaccacatg 20350



to top

>gb|BC114924.1| Homo sapiens hypothetical protein FLJ20245, mRNA (cDNA clone
           MGC:134782 IMAGE:40025256), complete cds
          Length = 1335

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 195 accaacctcatccacaccaa 214



to top

>emb|AL356299.16| Human DNA sequence from clone CTD-3216D2 on chromosome 20 Contains the
             AHCY gene encoding S-adenosylhomocysteine hydrolase, the
             5' end of the ITCH gene for itchy homolog E3 ubiquitin
             protein ligase (mouse), the CDC42P1 gene for cell division
             cycle 42 pseudogene 1, a pseudogene similar to part of
             laminin receptor 1 (ribosomal protein SA, 67kDa) (LAMR1)
             and two CpG islands, complete sequence
          Length = 152334

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 55    accaacctcatccacaccaa 74
             ||||||||||||||||||||
Sbjct: 21774 accaacctcatccacaccaa 21755



to top

>gb|AC141587.2| Homo sapiens chromosome 16 clone RP11-1046E19, complete sequence
          Length = 186890

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 36    ttggatacaatagcaattta 55
             ||||||||||||||||||||
Sbjct: 83796 ttggatacaatagcaattta 83777



to top

>gb|BT007625.1| Synthetic construct Homo sapiens S-adenosylhomocysteine hydrolase
           mRNA, partial cds
          Length = 1299

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 406 accaacctcatccacaccaa 425



to top

>gb|BT006697.1| Homo sapiens S-adenosylhomocysteine hydrolase mRNA, complete cds
          Length = 1299

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 406 accaacctcatccacaccaa 425



to top

>dbj|AK097610.1| Homo sapiens cDNA FLJ40291 fis, clone TESTI2028384, highly similar
           to ADENOSYLHOMOCYSTEINASE (EC 3.3.1.1)
          Length = 2355

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 698 accaacctcatccacaccaa 717



to top

>gb|AC182397.3| Pan troglodytes BAC clone CH251-345O12 from chromosome 16, complete
              sequence
          Length = 158303

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 36     ttggatacaatagcaattta 55
              ||||||||||||||||||||
Sbjct: 124787 ttggatacaatagcaattta 124768



to top

>emb|CR603449.1| full-length cDNA clone CS0DG007YH14 of B cells (Ramos cell line)
          of Homo sapiens (human)
          Length = 1646

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                              
Query: 55 accaacctcatccacaccaa 74
          ||||||||||||||||||||
Sbjct: 10 accaacctcatccacaccaa 29



to top

>emb|CR594678.1| full-length cDNA clone CS0DL004YE09 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 2111

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 484 accaacctcatccacaccaa 503



to top

>gb|AC007028.3| Homo sapiens chromosome 16 clone RP5-835P2, complete sequence
          Length = 148807

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 36     ttggatacaatagcaattta 55
              ||||||||||||||||||||
Sbjct: 125306 ttggatacaatagcaattta 125325



to top

>ref|NM_000687.1| Homo sapiens S-adenosylhomocysteine hydrolase (AHCY), mRNA
          Length = 2110

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 453 accaacctcatccacaccaa 472



to top

>dbj|AB169648.1| Macaca fascicularis brain cDNA, clone: QccE-12261, similar to human
           S-adenosylhomocysteine hydrolase (AHCY), mRNA, RefSeq:
           NM_000687.1
          Length = 2165

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 491 accaacctcatccacaccaa 510



to top

>gb|BC105194.1| Bos taurus S-adenosylhomocysteine hydrolase, mRNA (cDNA clone
           MGC:128223 IMAGE:7948966), complete cds
          Length = 2140

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 497 accaacctcatccacaccaa 516



to top

>gb|AC141248.2| Homo sapiens chromosome 16 clone RP11-1251B5, complete sequence
          Length = 173206

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 36    ttggatacaatagcaattta 55
             ||||||||||||||||||||
Sbjct: 23499 ttggatacaatagcaattta 23480



to top

>gb|AC140890.2| Homo sapiens chromosome 16 clone RP11-188D24, complete sequence
          Length = 172153

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 36     ttggatacaatagcaattta 55
              ||||||||||||||||||||
Sbjct: 126680 ttggatacaatagcaattta 126661



to top

>gb|AC004902.2|AC004902 Homo sapiens PAC clone RP5-823F17 from 7q36, complete sequence
          Length = 104154

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    ttggatacaatagcaattta 55
             ||||||||||||||||||||
Sbjct: 63676 ttggatacaatagcaattta 63695



to top

>gb|AC013734.4|AC013734 Homo sapiens BAC clone RP11-557B9 from Y, complete sequence
          Length = 180019

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    ttggatacaatagcaattta 55
             ||||||||||||||||||||
Sbjct: 85164 ttggatacaatagcaattta 85183



to top

>gb|AC136428.3| Homo sapiens chromosome 16 clone RP11-104C4, complete sequence
          Length = 193708

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 36    ttggatacaatagcaattta 55
             ||||||||||||||||||||
Sbjct: 94396 ttggatacaatagcaattta 94377



to top

>gb|AY892700.1| Synthetic construct Homo sapiens clone FLH024356.01L
           S-adenosylhomocysteine hydrolase (AHCY) mRNA, partial
           cds
          Length = 1299

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 406 accaacctcatccacaccaa 425



to top

>gb|AY890211.1| Synthetic construct Homo sapiens clone FLH024359.01X
           S-adenosylhomocysteine hydrolase (AHCY) mRNA, complete
           cds
          Length = 1299

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 406 accaacctcatccacaccaa 425



to top

>emb|AL928960.25| Mouse DNA sequence from clone RP23-413K16 on chromosome 2, complete
              sequence
          Length = 195733

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 282    gagcaccatgcacaaaacca 301
              ||||||||||||||||||||
Sbjct: 152033 gagcaccatgcacaaaacca 152052



to top

>gb|BC011606.2| Homo sapiens S-adenosylhomocysteine hydrolase, mRNA (cDNA clone
           MGC:2319 IMAGE:3139231), complete cds
          Length = 2174

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 480 accaacctcatccacaccaa 499



to top

>dbj|AP000974.5| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-700A24, complete
             sequence
          Length = 94359

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 55    accaacctcatccacaccaa 74
             ||||||||||||||||||||
Sbjct: 74780 accaacctcatccacaccaa 74799



to top

>ref|NM_001034315.1| Bos taurus S-adenosylhomocysteine hydrolase (AHCY), mRNA
          Length = 2140

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 497 accaacctcatccacaccaa 516



to top

>gb|M61832.1|HUMAHCY2 Human S-adenosylhomocysteine hydrolase (AHCY) mRNA, complete cds
          Length = 2084

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 449 accaacctcatccacaccaa 468



to top

>gb|M61831.1|HUMAHCY Human S-adenosylhomocysteine hydrolase (AHCY) mRNA, complete cds
          Length = 2211

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 55  accaacctcatccacaccaa 74
           ||||||||||||||||||||
Sbjct: 453 accaacctcatccacaccaa 472


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,568,938
Number of Sequences: 3902068
Number of extensions: 2568938
Number of successful extensions: 47401
Number of sequences better than 10.0: 35
Number of HSP's better than 10.0 without gapping: 35
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47344
Number of HSP's gapped (non-prelim): 57
length of query: 312
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 290
effective length of database: 17,147,199,772
effective search space: 4972687933880
effective search space used: 4972687933880
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top